A green supply chain network design model for enhancing competitiveness and sustainability of companies in high north arctic regions

... domestic and international suppliers, and it mainly serves local customers In order to design and maintain an efficient and sustainable supply chain with relatively low risks, the supply chain manager ... literature analysis of definitions for green and sustainable supply chain management Journal of Cleaner Production 2013, 52, 329-341 [7] Stivastava, S.K Gr...

Ngày tải lên: 09/09/2015, 10:32

... Every Woman Matters A Report on Accessing Primary Health Care for Black Women and Women of Colour in Ontario Toronto, August 2010 Report preparation Charmaine C Williams Notisha Massaquoi ... accessible health care model fig Primary Health Care Logic Model To increase access to primary health care for Black Women and Women of Colour in Toronto...

Ngày tải lên: 14/03/2014, 12:20

... Dong Yang, Paul Dixon, Yi-Cheng Pan, Tasuku Oonishi, Masanobu Nakamura and Sadaoki Furui 2009 Combining a Two-step Conditional Random Field Model and a Joint Source Channel Model for Machine Transliteration, ... Lafferty, Andrew McCallum, and Fernando Pereira 2001 Conditional Random Fields: Probabilistic Models for Segmenting and Labeling Sequence Data., Proce...

Ngày tải lên: 17/03/2014, 00:20

... global joint model for morphological analysis The idea of this model is to jointly predict the set of possible tags and lemmas of words In addition to modeling dependencies between the tags and ... bouncer and bounce will detect a problem with this assignments and will be able to correct the tagging and lemmatization error for bouncer The main source of information our...

Ngày tải lên: 17/03/2014, 01:20

... doi:10.1186/1743-422X-7-13 Cite this article as: Ho et al.: Establishment of one-step SYBR greenbased real time-PCR assay for rapid detection and quantification of chikungunya virus infection Virology Journal 2010 ... Page of Figure One-step SYBR green-based RT-PCR for detection of CHIKV infection (A) Amplification profile and (B) the standard cur...

Ngày tải lên: 12/08/2014, 04:21

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGA...

Ngày tải lên: 14/08/2014, 16:21

... factors for CVD and evaluation of VO 2peak should be incorporated in clinical practice Finally, these finding represent an urging need for developing effective physical training interventions for patients ... Reduced peak oxygen uptake and implications for cardiovascular health and quality of life in patients with schizophrenia Jørn Heggelund1,2,...

Ngày tải lên: 11/08/2014, 16:21

... Crucially, any information about repair is stripped from the input, including partial words, repair symbols , and interruption point information While an integrated system for processing and parsing speech ... start and end of the reparandum 108 Conclusion This paper has described a novel method for parsing speech that contains speech repairs This system achieves high accuracy i...

Ngày tải lên: 20/02/2014, 09:20

... here are for prediction on only TI repair utterances 6We performed the same analysis for the last and first syllables in the reparandum and repair, respectively, and for normalized f0 and energy; ... presented a "speech-first" model, the Repair Interval Model, for studying repairs in spontaneous speech This model divides the repair event into a reparandum interval,...

Ngày tải lên: 20/02/2014, 21:20

... observation of the first colonies in hematopoietic colony assays [55 ] The hematopoietic transcription factors SCL and GATA-2 were also expressed in these cells between days and 21 of differentiation ... indicated that the placenta acts as an additional extramedullary hematopoietic organ during embryonic and fetal development [52 ,53 ] Hematopoietic precursors found...

Ngày tải lên: 22/03/2014, 17:20

... compare the performance of different text representation models for event detection, namely BurstVSM and boostVSM (He et al., 2007b; He et al., 2007a).7 For different representation models, we use ... proposed methods are both effective and efficient Burst-based Text Representation In this section, we describe the proposed burst-based text representation model, denoted...

Ngày tải lên: 23/03/2014, 14:20

... growth rate and the specific production rate to [LaH] and pH, the accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of ... capacity of the medium are known The amount of undissociated lactic acid is then further related to the total amount of lactic acid LaHtot and the pH by the lactic...

Ngày tải lên: 05/05/2014, 08:44