THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 3

... to 15 d-PGJ2, while 15 d-PGJ2 resulted in the maximal reduction in the number of colonies formed by MDA-MB-2 31 cells expressing the highest level of PPARγ receptor 11 2 Figure 14 : PPARγ agonists ... cells and only a 36 % down- regulation in T47D cells (Figure 14 D) Interesetingly, the extent of inhibition on cologenic ability of different breast cancer cell...

Ngày tải lên: 09/09/2015, 10:19

... 1. 1.5 Ligands and physiological functions of PPARα and PPARδ 1. 1.6 Ligands of PPARγ 1. 1.7 PPARγ and adipogenesis 10 1. 1.8 PPARγ and insulin sensitization 12 1. 1.9 ... PPARs and cancer 13 1. 1 .10 PPARγ and breast cancer 15 1. 2 ESTROGEN RECEPTORS (ERS) 18 1. 2 .1 Identification and structures of ERs 18 1. 2.2 Mechanism of action of ... PPARγ -...

Ngày tải lên: 09/09/2015, 10:19

... ROS/RNS 10 5 contributes approximately 20 % of the overall down- regulation of NHE1 transcription by 5M of 15 d-PGJ2 10 6 Figure 11 : ROS/RNS contributes to down- regulation of NHE1 (A) MCF-7 (3 X105 cells/6-well ... (Figure 11 C) In contrast, 15 d-PGJ2 caused 61% reduction in NHE1 mRNA in the absence of NAC We reasoned that this difference in magnitude of dow...

Ngày tải lên: 09/09/2015, 10:19

... EFFECT OF PPARγ ON NHE1 Given that the presence of estrogen blocked the down- regulation of NHE1 expression induced by PPARγ lgiands, we next investigated the role of estrogen receptor in PPARγ -mediated ... protein and mRNA is mediated by estrogen recptor alpha 13 1 Figure 19 : Re-expression of ERα blocks PPARγ -mediated down- regulation of NHE1 ex...

Ngày tải lên: 09/09/2015, 10:19

... basis and biological significance." Oncogene 25( 51) : 67 31- 67 48 Bunone, G., P A Briand, et al (19 96) "Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct ... hepatotoxicity: another lesson from troglitazone." Diabetologia 51( 11) : 210 8 211 6 Jurka, J and A Milosavljevic (19 91) "Reconstruction and analysis of human...

Ngày tải lên: 09/09/2015, 10:19

... PPARγ -mediated NHE1 down- regulation From the results shown above, we concluded further that the DNA binding ability of ERα is involved in inhibiting PPARγ -mediated NHE1 repression 15 1 15 2 Figure ... 30% reduction in NHE1 mRNA in ER positive MDA-MB-2 31 cells It is interesting that in the absence of fulvestrant, 1 M of 15 d-PGJ2 brought down NHE1 mRNA to 50 % of...

Ngày tải lên: 09/09/2015, 10:19

... mgÆmL)1 BSA and stored at )20 °C Electrogenic BSP uptake inhibition by antibodies The kinetics of bilitranslocase transport activity inhibition by antibodies were examined by preincubating 24 lL ... addition of protein (2.6 ± 0.04 lmolÆmin)1Æmg protein)1, with lg valinomycin), as well as of K+ (6.25 ± 0.16 unitsÆmEq)1 K+, with lg valinomycin) and valinomycin (0.5...

Ngày tải lên: 20/02/2014, 01:20

... Endocrine/Explorations/Endocrine Function Chapter 11 1 1- 1 Muscular/Anatomy/Skeletal Muscle 1 1- 3 Muscular/Histology/Cardiac Muscle Muscular/Histology/Smooth Muscle xxvi 1 1- 4 1 1- 5 1 1- 6 1 1- 8 1 1- 1 2 1 1- 1 5 1 1- 1 8 1 1- 1 9 1 1- 2 0 1 1- 3 1 ... Tape Tape Chapter 11 1 1- 8 Tape 1 1- 1 2 Tape 1 1- 1 6 Tape Chapter 15 1 5-6 Tap...

Ngày tải lên: 11/08/2014, 06:21

... Tat1 and Tat2 RNAs in the untreated RRL system Translation of Tat1 and Tat2 RNAs in the untreated RRL system The top three lanes depict the Glob-Fluc, UTRTat1-Rluc and UTRTat2-Rluc RNAs used in the ... one of the DNA fragments corresponding to the complete 5' UTR of Tat1 and Tat2 RNAs, to the deleted 5' UTR (delta R-U5) of Tat1 and Tat2 RNAs, to th...

Ngày tải lên: 12/08/2014, 23:22

... RGYVYQGL (VSV8) and physiological low-molecular mass ligands of the ER lumenal compartment (Ca2+ and ATP) , known to regulate the function of Grp94 as a protein chaperone [4,11,12] Thus, the SPR binding ... ligands of the chaperone in the ER lumenal compartment which may perturb this interaction Binding of the viral immunogenic octapeptide VSV8...

Ngày tải lên: 30/03/2014, 11:20

... exchanger- 1 (NHE1) 1. 1 .1 NHE1 isoforms and NHE1 structure 1. 1.2 Regulation of NHE1 1. 1.3 Physiological function of NHE1 1. 1.4 Role of NHE1 in cancer progression 11 ... formation of Hsp90/Akt/NHE1 complex in MCF10AT1 12 4 3.3.3 Akt regulates NHE1 protein expression in MCF10CA1a 13 1 3.3.4 NHE1 interacts with Akt in MCF10CA1a and not MCF10CA1h 13 4 3.3.5...

Ngày tải lên: 10/09/2015, 09:29

... REGULATION OF NHE1…………… 11 0 3B .1 DOWN -REGULATION OF NHE1 BY H2O2 11 0 3B .1. 1 Identification of crucial region in the promoter of NHE1 11 0 3B .1. 2 H2O2 down-regulates 0 .15 kb proximal NHE1 promoter ... signaling 21 1.3.4 Regulation of estrogen receptors 23 1. 3.5 Estrogen and estrogen receptors in human breast cancer 27 v 1. 4 THE SODIUM HYDROGEN EXC...

Ngày tải lên: 10/09/2015, 15:49

... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT ... HPV18_7239.rev ACAACAACAACCATACATACC HPV18_ 7168 .for TGTTGTGTTTGTATGTCCTGT HPV18_7 350 .rev CCACAAACACAAATACAGTTGTT HPV18_7378.for TATTGTCCTGTATTTCAAGTTAT HPV18_ 757 6.rev CGC...

Ngày tải lên: 02/10/2015, 17:15

... isonicotinoyl hydrazone class as effective antiproliferative agents II The mechanism of action of ligands derived from salicylaldehyde benzoyl hydrazone and 2-hydroxy-1-naphthylaldehyde benzoyl hydrazone ... controls Apolactoferrin was from Calbiochem A polyclonal rabbit anti-(human ferritin) Ig was from Roche Diagnostics All other chemicals were of analytical reagent qual...

Ngày tải lên: 08/03/2014, 22:20

... between the nickel ion and the protein is the key feature of the binding process Further evidence that SlyD interacts with nickel ions with a : stoichiometry is provided by the analysis of the changes ... Structure and interactions of SlyD L Martino et al The constant of binding of the reaction Kb is dened as: Kb ẳ ẵPL ẵP ẵL 3ị The total concentrati...

Ngày tải lên: 30/03/2014, 01:20