Shaping artificial receptors through nanoparticle surface imprinting of biomolecules using miniemulsion polymerization

... objective of this thesis is to develop artificial receptors through nanoparticle surface imprinting via miniemulsion polymerization The receptors can be used for recognition and adsorption of biomacromolecules ... imprinted memory of viruses was created on nanoparticles A mechanism of imprinting and recognition of viruses through miniemulsion polymerization...

Ngày tải lên: 09/09/2015, 10:19

... Surface Plasmon Spectroscopy As high refractive prisms are used for the excitation of surface plasmons in the examples of figure 2.3, the momentum of the incident light beam in the plane of the ... and the position of the laser spot on aperture should not change upon movement of the pinhole along the detector arm Otherwise the height of pinhole 2,...

Ngày tải lên: 08/11/2015, 17:01

... describe sieving, diffusion and convection of a band of biomolecules passing through a repeated array of nanofilters 14 Chapter Introduction 1.4 Organization of the thesis This thesis is composed of ... approaches 2.1 Free-solution diffusion coefficient of rod-like DNA Diffusion of particles in a solution from a region of high concentration to regions of low concentrati...

Ngày tải lên: 11/09/2015, 09:03

... of the polymerisation conditions with the template protein, where the challenge is to conserve the native structure of the template so as to imprint the ‘correct’ conformation of the target protein ... extended to the imprinting of macromolecules 2.3.2 Surface imprinting One of the major challenges faced in molecular imprinting, especially for the im...

Ngày tải lên: 08/11/2015, 16:46

... and absorptive capacity So the IS will be one land cover category for indicating the urban area in this study In digital interpretation, the confusion of the bare land, moisture land and urban ... and East of the city and along the main roads Fig shows the trend of urban IS development with a strong slope between 1998 and 2006, indicating that Ho Chi Minh C...

Ngày tải lên: 05/03/2014, 16:20

... displacements of residues IV CONCLUSIONS We have built the application for charaterization of GPCRs through the use of bioand chemo- informatics tools The server will play the role for doing homology modeling ... CHARACTERIZATION OF G PROTEIN COUPLED RECEPTORS 47 Fig The lowest Autodock VINA affinity of docked ligands generated by the receptor built by...

Ngày tải lên: 31/10/2015, 10:39

... However, little information concerning the surface characteristics of H2-producing sludge in acidogenic fermentative process is available in literature Therefore, the main objective of this study ... limiting viscosity of the sludge changed slightly with the fermentation time in both trails (Fig 4), at a level of 38 mPa s, suggesting invariable rheological charact...

Ngày tải lên: 05/09/2013, 09:08

... labeling at any temperature (Fig 5A) A similar fast activation was observed for Y2 receptors of rat forebrain cells (not shown) This was contrasted by a gradual, steady accumulation of surface Y1 sites ... in a- actinins, adaptins and selectins A role for single intramembrane thiols could also be assumed, based on the lack of Y2 activation by MTSET, and limited activat...

Ngày tải lên: 22/02/2014, 04:20

... enzymes from Paenibacillus sp A11 (A11) and Bacillus macerans (BM) form CD7 and CD6 as their major products, respectively [13,14] The imprinting of the enzymes with CD8, resulting in high levels of ... comparison The effect of pH on the activity of the different CGTase preparations from A11 and BM was Table Degree of derivatization of the CGTases from A1...

Ngày tải lên: 07/03/2014, 10:20

... interfere with the way the paint bonds to the metal surface, creating gaps in the coating that encourage corrosion For this reason, any greases deposited on the metal during the assembly of the car body ... 3) The results demonstrate the superior cratering resistance of the newer type of cathodic electrocoating X-Polymers-F -Car Bodies- 7 Table - The effect...

Ngày tải lên: 07/03/2014, 11:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

Ngày tải lên: 16/03/2014, 03:20

... understanding of the surfaces of diamond nanostructures we are interested in extending these research efforts to include diamond nanowires Presented here is a density functional theory (DFT) study of the surface ... ionic steps Diamond nanowires Four infinite diamond nanowires were included in this study, consisting of dehydrogenated and 205 monohydrogenated versions of...

Ngày tải lên: 16/03/2014, 15:38

... environment teaching methods through teaching life skills to their students - Rate propaganda activities, raising environmental awareness at the HCMC University of Technology - Propose measures propaganda ... Literature, painting, sculpture, film, drama, music is the kind of culture contributes to enrich the soul of every man and guide them to the lofty goals...

Ngày tải lên: 22/03/2014, 09:20

... specific activity of Cel 7A for crystalline cellulose This approach has several advantages: (1) Amax provides a measure of the surface area of crystalline cellulose available as a substrate of cellulase ... X-ray fiber patterns were obtained on a at imaging plate, R-AXIS IV++ (Rigaku Corporation, Tokyo, Japan), at room temperature using synchrotron radiation with a w...

Ngày tải lên: 23/03/2014, 10:21