Robust inhibition of hepatitis c viral propagation
... Blue – NS4A cofactor; Red – Helicase mimic; Licorice - substrate Protease; Blue – NS4A cofactor; Pink – Pink – Helicase mimic; Licorice - substrate %" c Covalent bonding &" '" $" Scaffold and ... change can be accounted for with the change in the molecule’s coulombic energy upon conformational change Hence the thermodynamic process to calculate the total electrostatic free energy change ......
Ngày tải lên: 09/09/2015, 10:14
... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... LOD of the duplex real-time RT-PCR assay was 38.99 IU/ml and the specificity was 100% Furthermore, the cost of the duplex real-time RT-PCR assay was considerably lower than t...
Ngày tải lên: 12/08/2014, 04:20
... Orlando G, Casciani CU Hepatitis C virus infection in Italian kidney graft recipients Changing risk factors and hepatitis C virus genotypes Ital J Gastroenterology Hepatology 1997; 29:448-55 67 Cheung ... HE, Kannemeyer J Genotyping of hepatitis C virus infection in South Africa J Clin Microbiol 1995; 33:1679-81 82 Huy TT, Abe K Molecular epidemiology of hepatitis B an...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... histological, biochemical, genetic and demographic markers that may further predict the outcome of HCV infections Figure Natural History of HCV Infection Extrahepatic Manifestations Chronic HCV infection ... patients not clear the virus by months, and chronic hepatitis develops The rate of chronic HCV infection is affected by many factors, including the age at time of infectio...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... J Med Sci 2006, 30 Figure Life cycle of HCV The steps of the viral life cycle are depicted schematically The topology of HCV structural and nonstructural proteins at the endoplasmic reticulum ... steps for simplicity, may occur in a tightly coupled manner The replicon system For many years, HCV research was hampered by the extremely restricted host range and the inefficiency of in vi...
Ngày tải lên: 02/11/2012, 10:00
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt
... ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased from Sigma), and the pKK plasmid as a template [32] The resulting fragment was cloned into NcoI and BamHI sites of the ... Suv3(D1-159) and WNV NTPase/helicases The NTPase/helicase domain of HCV NS3 was expressed in E coli and purified as described previously [30], with certain modi...
Ngày tải lên: 08/03/2014, 02:20
Diagnosis, Management, and Treatment of Hepatitis C: An Update docx
... Level C) Treatment of African Americans The prevalence in the U.S of anti-HCV is higher in African Americans (3%) than in non-Hispanic whites, (1.5%) and Hispanics (1.3%).7 Compared to Caucasians, ... effects and their management is an integral component of treatment and is important for a successful outcome Selection of Patients for Treatment Current recommendations for...
Ngày tải lên: 08/03/2014, 14:20
Management of hepatitis C pot
... hepatitis C 11 Management of hepatitis c 6 Acute hepatitis C 6.1 natural history The incidence of acute hepatitis C is unknown but can be estimated from the prevalence of chronic hepatitis C (CHC).63 ... (CHC).63 Acute hepatitis C infection is usually asymptomatic 64 The full clinical spectrum of acute hepatitis C symptoms can occur but is rare (
Ngày tải lên: 08/03/2014, 14:20
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... culture of infected hepatocytes To succeed in obtaining HCV infection in primary human hepatocytes, an existing model of hepatitis B virus infection was used to determine optimal infection conditions ... hepatocytes and lymphocytes in vitro In summary, use of HCV-containing sera to reconstitute the entire life cycle of HCV in vitro has proved to be very d...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGAT...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf
... independently analyzed by two investigators The staining score was calculated from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), ... http://www.translational-medicine.com/content/9/1/64 Page of 10 Figure Analysis of the expression and localization of phosphorylated c-MET in RMS tissue samples Represen...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Novel type I interferon IL-28A suppresses hepatitis C viral RNA replication" pptx
... other type I interferons Thus, it is important to thoroughly investigate these interferons, and to explore the possibility of potential clinical application Hepatitis C viral (HCV) infection is ... effect on the IL-28A- induced anti-HCV activity The IL-28A receptor complex consists of a ligand-binding chain, IL-28R, and an accessory receptor chain, IL-10R2 So it is logical to det...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx
... to data analysis and preparation of manuscript HO'S performed all the experiments and contributed to data analysis and preparation of manuscript CM contributed to the experiments and data analysis ... outer forward, OF (I), ATGGCATGGGATATGAT; outer reverse, OR (I), AAGGCCGTCCTGTTGA; inner forward, IF (I), GCATGGGATATGATGATGAA; inner reverse, IR (I), GTCCTGTTGATGTGCCA The PCR rea...
Ngày tải lên: 20/06/2014, 01:20