Development of ultra sensitive and selective nanoparticle based biosensors
... DEVELOPMENT OF ULTRA- SENSITIVE AND SELECTIVE NANOPARTICLE- BASED BIOSENSORS WANG HONGBO (B S., ZHEJIANG UNIVERSITY) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMISTRY ... of DNA damage It is the particular structure and properties that nucleic acids can be used as ideal materials for the development of ultra- sensitive and se...
Ngày tải lên: 09/09/2015, 10:06
... developing novel biosensors, based on oligonucleotide- modified metal nanoparticles, for ultrasensitive metal ion and DNA detections In Chapter 2, we have demonstrated a gold nanoparticle/ DNA ... ULTRA- SENSITIVE AND SELECTIVE DETECTION BASED ON OLIGONUCLEOTIDE/ NANOPARTICLE BIOSENSORS XUE XUEJIA (M.Eng., SOUTHEAST UNIVERSITY) A THESIS ... colorimetric method has b...
Ngày tải lên: 10/09/2015, 15:52
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
báo cáo khoa học: " Translating global recommendations on HIV and infant feeding to the local context: the development of culturally sensitive counselling tools in the Kilimanjaro Region, Tanzania" doc
... WHO/UNICEF guidelines on HIV and infant feeding and related generic counselling tools to the local social and cultural context of infant feeding and HIV in the Kilimanjaro Region of northern Tanzania ... for information exchange related to infant feeding in the context of HIV counselling and testing Development of performance an...
Ngày tải lên: 11/08/2014, 05:22
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering dis...
Ngày tải lên: 12/09/2015, 08:20
Selection of aptamers for signal transduction proteins and development of highly sensitive aptamer probes
... for future development of aptamer probes 24 Chapter Selection of aptamers for signal transduction proteins by capillary electrophoresis Chapter Selection of aptamers for signal transduction proteins ... various isoforms of PAKs and MRCKs For the purpose of this work, PAK1 and MRCK were used for aptamer selection Non-SELEX was the method o...
Ngày tải lên: 14/09/2015, 08:26
DEVELOPMENT OF THE OZONIZER AND OZONATION TECHNOLOGY FOR WATERWORKS IN JAPAN
... In Raw Water On The Ozonation Of Geosmin And 2-MIB OZONE SCIENCE & ENGINEERING 15, 1-18 Morioka, T (2001) The Study on the Application of Ozonation for the Removal of the Taste and Odor-Causing ... concentration and decomposition RESEARCH AND DEVELOPMENT IN OZONATION TECHNOLOGY Objectives of ozonation The main objectives of ozonation are to re...
Ngày tải lên: 05/09/2013, 08:40
THE SUSTAINABLE DEVELOPMENT OF TREE CROPS AND THE PREVENTION OF VEGETATION FIRES IN SOUTH SUMATRA, INDONESIA pptx
... I.P Anderson, I.D Imanda and Muhnandar Vegetation fires in Sumatra ,Indonesia: the presentation and distribution of NOAA-derived data I.P Anderson, I.D Imanda and Muhnandar Vegetation fires in Indonesia: ... I, South Sumatra Land management in South Sumatra Province, Indonesia: fanning the flames The institutional causes of vegetation fires J.M Bompard...
Ngày tải lên: 08/03/2014, 10:20
highly sensitive and selective ammonia gas sensor - solid state
Ngày tải lên: 19/03/2014, 16:48
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx
... conventional ab T cells This minireview focuses on this aspect of Itk, its role in the development and function of iNKT and NKT- like cd T cells Itk and i NKT cell development NKT cells are a subset ... Qi et al Fig Involvement of Itk in the development of i NKT and NKT- like cd T cells During T- cell development in the thymus,...
Ngày tải lên: 28/03/2014, 22:21
Risk Factors Affecting the Development of Tuberculosis Infection and Disease in Household Contacts of Patients with Pulmonary Tuberculosis pptx
... et al Risk Factors Affecting the Development of Tuberculosis Infection and Disease in Household Contacts of Patients with Pulmonary Tuberculosis (such as uncle, grandfather, cousin) The definitions ... Affecting the Development of Tuberculosis Infection and Disease in Household Contacts of Patients with Pulmonary Tuberculosi...
Ngày tải lên: 29/03/2014, 03:20
báo cáo hóa học:" The ability of cancer-specific and generic preference-based instruments to discriminate across clinical and self-reported measures of cancer severities" doc
... as the proportion of the sample within each group The QOL scores of the investigated instruments are reported as Tukey’s values Before testing the ability of the instruments to discriminate across ... excellent to fair to extremely poor Cancer- Specific Instruments For this study, two cancer- specific instruments were used: the EORTC QLQ-C30 and...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo hóa học: " Quality of service implications of power control and multiuser detection-based cross-layer design" docx
... article as: Korger et al.: Quality of service implications of power control and multiuser detection-based cross-layer design EURASIP Journal on Wireless Communications and Networking 2011 2011:9 ... article we start out with a detailed review and discussion of available CLDs for both power control and MUD Eventually, we are concerned with the Quality of...
Ngày tải lên: 21/06/2014, 03:20
Báo cáo hóa học: " Bioconjugates of Glucose Oxidase and Gold Nanorods Based on Electrostatic Interaction with Enhanced Thermostability" ppt
... formation of a protein–polyelectrolyte complex at pH [ pI with polycations and at pH \ pI with polyanions can be easily achieved The bioconjugates of GOD and GNRs were fabricated using the electrostatic ... solution (10 mM, pH 7.0) Preparation of GOD/GNRs Bioconjugates The combination of GOD and GNRs was achieved using electrostatic interaction In detail, the above...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " The Influences of Cell Type and ZnO Nanoparticle Size on Immune Cell Cytotoxicity and Cytokine Induction" pptx
... Effect of ZnO NP Size on Cytotoxicity and ROS Production To evaluate the relationship between ZnO NP size and its toxic potential, three different sizes of ZnO NPs (4, 13, and 20 nm) were concurrently ... Control of ZnO Nanoparticles To evaluate the relationship between NP size and cytotoxic properties on various types of immune cells, ZnO NPs (4–20...
Ngày tải lên: 22/06/2014, 00:20