Strategic environmental assessments may be used to compare d

Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process

... how SEA may be applied to compare different energy scenarios and how, by incorporating the wider impacts considered during the SEA process, a more sustainable power plan can be developed It also ... leads to lower demand and reduces the need to build more power plants of all types Although still substantial, the financial costs and...

Ngày tải lên : 08/09/2015, 23:32

50
456
0

Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"

... consumption and risk of diabetes or of interactions between poultry consumption and BMI and the risk of type DM Red meat consumption was associated with a modest increase in the risk of type DM in the ... and type DM may also reflect other unidentified factors It may be possible that consumption of red meat and processed meat may not incre...

Ngày tải lên : 31/10/2012, 16:49

8
701
0

Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt

... of NtrC1 ATPase The presence of trace quantities of AK thus caused the apparent ADP hydrolysis, by generating ATP to be used by the ATPase Discussion It is widely known that proteins cannot be ... the other of which was enriched for ADPase activity Despite the fact that the above results were consistent with NtrC1 ATPase being able to hydrolyze ADP, the ADPase activit...

Ngày tải lên : 16/03/2014, 04:20

9
401
0

Báo cáo y học: " Quantitative PCR used to Assess HIV-1 Integration and 2-LTR Circle Formation in Human Macrophages" potx

... PBLs and HIV-1 integration was measured by two-step quantitative PCR, and (C) 2-LTR circle formation was measured by real-time PCR (**p < 0.01) HIV-1 Integration in human macrophages Human monocyte-derived ... of HIV-1 infection include viral entry by binding to the main receptor CD4 and either of two coreceptors CCR5 or CXCR4 Upon membrane fusion, the viral...

Ngày tải lên : 12/08/2014, 02:20

6
370
0

Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx

... Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine (ADMA) ... Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of...

Ngày tải lên : 13/08/2014, 03:20

7
265
0

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

... Genetic Vaccines and Therapy 2005, 3:5 Background Lung cancer is a leading cause of cancer death in Australia and the world [1,2] There are two types of lung cancers, non small cell (NSCLC) and ... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cy...

Ngày tải lên : 14/08/2014, 19:22

12
314
0

Prospects of concentrating solar power to deliver key energy services in a developing country

... to south: I: Tarapaca, II: Antofagasta, III: Atacama, IV: Coquimbo, V: Valparaiso, RM: Region Metropolitana, VI: Libertador General Bernardo O’Higgins, VII: Maule, VIII: Biobio, IX: Araucania, ... potential for satisfying other demands as well, such as processing heat for industry, co-generating of heating, cooling and power, water desalination, household cooking and small-scale manufact...

Ngày tải lên : 05/09/2013, 14:58

12
491
0

Evaluate and compare different organizational structures and culture

... site: http://www.microsoft.com/presspass/exec.mspx?pf=true II Detail: Evaluate and compare different organizational structures and culture: Getting the structure right is important for any organization, ... Problems and Practice Paul Chapman Veeramuthu (2008) Organizations and Behavior, Hanoi: National Economic University 2- page handout on the Organizational Structure a...

Ngày tải lên : 11/11/2013, 16:40

20
368
0

“ A Powerful Collection of Sales Techniques to Help You Overcome Objections and Close More Sales Than Ever Before! ” doc

... to make your first training appointment today or would tomorrow be better for you? ” “Were you going to work out today ?” “What other errands you have to run today ?” “Did you want to go ahead and ... early rather than too seldom and too late! You need to take advantage of any opportunity you have to gain commitment from your guest You not want to...

Ngày tải lên : 16/03/2014, 15:20

24
529
0

Báo cáo hóa học: " Research Article Algorithms of Common Solutions to Generalized Mixed Equilibrium Problems and a System of Quasivariational Inclusions for Two Difference Nonlinear Operators in Banach Spaces" pdf

... Motivated by the work of Combettes and Hirstoaga 34 in a Hilbert space and Takahashi and Zembayashi 33 in a Banach space, Zhang 35 and also authors of 36 obtained the following lemma Lemma 2.2 see 35 ... Saewan and P Kumam, A hybrid iterative scheme for a maximal monotone operator and two countable families of relatively quasi-nonexpansive mappings for ge...

Ngày tải lên : 21/06/2014, 07:20

23
399
0

How to Beat the Energy Thieves And Make Your Life Better Emotions doc

... so they can divert you from your true path and destroy your life and your existence… How to Beat The Energy Thieves And Make Your Life Better! Emotions Energy Thieves Within Your Emotions Energy ... Emotions How to Stop Emotions Damaging Your Energy and Your Life Fear, Loneliness, Anger, Hatred, Envy, Greed, Lying, Selfishness, Arg...

Ngày tải lên : 28/06/2014, 00:20

97
340
1

Báo cáo y học: "Comparison of mannitol and methacholine to predict exercise-induced bronchoconstriction and a clinical diagnosis of asthma" pdf

... escalating doses and a hand-held dry powder inhaler device Safety and efficacy of mannitol as a BPT were established in a large Phase III clinical trial in patients with asthma and in healthy ... Relationship between airway responsiveness to mannitol and to methacholine and markers of airway inflammation, peak flow variability and quality of life in asthma...

Ngày tải lên : 12/08/2014, 14:20

13
407
0

Chapter 105. Malignancies of Lymphoid Cells (Part 9) Two other features may be used to assess pptx

... g/dL)] and number of extranodal sites with number of nodal sites (more than four) Low risk (zero or one factor) was assigned to 36% of patients, intermediate risk (two factors) to 37%, and poor ... been proposed that better predicts outcome of rituximab plus chemotherapy-based programs (Table 105 -9) CT scans are routinely used in the evaluation of patients with all subtypes...

Ngày tải lên : 07/07/2014, 04:20

5
351
0

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Ngày tải lên : 08/08/2012, 17:20

5
1.3K
3

Tài liệu Động từ tiếng Anh : Can, may, be able to docx

Ngày tải lên : 13/12/2013, 18:16

1
993
8