Porin mediated transport of fluoroquinolones in mycobacterium tuberculosis

... effects of PBS washes on the inhibition of ciprofloxacin accumulation 134 31 The effects of increasing pH on the inhibitory effects of spermidine 134 32 MIC curves of spermidine and cadaverine against ... curves of ciprofloxacin against M bovis BCG in the presence of spermidine and cadaverine 136 34 Kill-kinetics of M bovis BCG during a 5-days incubation period with ciproflo...

Ngày tải lên: 08/09/2015, 19:17

... representation of the roles of the FadD proteins encoded by the DIM + PGL locus in the biosynthesis of DIMs and related compounds in Mycobacterium tuberculosis The role of the activation enzymes FadD22, FadD26 ... protein involved in the biosynthesis of PGL-tb in M tuberculosis These data also established that, in contrast to fadD26, f...

Ngày tải lên: 15/03/2014, 11:20

... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... kinases PknF and PknG of Mycobacterium tuberculosis: characterization and localization Microbiology 147, 2307–2314 12 Gopalaswamy R, Narayanan PR & Narayanan S (...

Ngày tải lên: 16/03/2014, 14:20

... in DevR function was assessed in vitro and in vivo using DevR K182G or K182A mutant protein and fdxA promoter harbouring mutations in C8 or ⁄ and T9 base in the primary DevR binding site, P The ... important for interaction with Lys182 of DevR (Fig 2A) A comparison of the footprints and their profiles shows that the C8 mutation in the P box abo...

Ngày tải lên: 22/03/2014, 16:20

... phosphatases may possibly To examine whether MursiF retains kinase activity in spite of the loss of critical residues involved in ATP binding, as observed in our in silico analysis of MursiF WKD (Fig 3A), ... dehydrogenase M avium paratuberculosis MAV_1619 Hypothetical protein Hypothetical Mjls_2718 protein Sensor ResponseHypothetical RsbW RsbV Kinase regulator prot...

Ngày tải lên: 30/03/2014, 02:20

... can be generated in D Deleting this set Figure Fatty acid Biosynthesis (Source KEGG pathway database) Fatty Acid Synthesis Pathway in Mycobacterium tuberculosis H37rv The pathway was downloaded ... India Authors’ contributions VB contributed in pathway modelling, programming and applying graphs in biology UR analysed the biological data TK was involved in applying gra...

Ngày tải lên: 13/08/2014, 16:20

... contributions to its virulence [3] At the branch point of the tricarboxylic acid (TCA) cycle and glyoxylate bypass, isocitrate dehydrogenase (ICD), involved in the TCA cycle, and ICL, involved in the glyoxylate ... construction of a kinetic model of the TCA cycle and glyoxylate bypass in M tuberculosis, and we study the likely metabolic consequenc...

Ngày tải lên: 13/08/2014, 23:20

... TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT ... P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experim...

Ngày tải lên: 23/03/2014, 04:21

... erosion In the third and final experiment, the effects of soil properties on the fate and transport of chlortetracycline (CTC), tylosin iv (TYL), and sulfamethazine (SMT) were examined by conducting ... paper include (1) sampling of soil cores and conducting experiments, (2) most of the gathering and interpretation of literature, and (3) most of the...

Ngày tải lên: 13/11/2014, 09:16

... in terms of transformation products, as a factor of application mode and soil This thesis updated the knowledge of the environmental behavior of sulfadiazine, since we investigated the fate in ... understanding of sorption, transformation and transport of the veterinary antibiotic sulfadiazine To this aim, laboratory experiments with the radio-labeled compou...

Ngày tải lên: 25/11/2015, 15:20

... the discriminating behaviour of Mt-GluRS in E coli Studies on Tt-GluRS indicated that discriminating and nondiscriminating GluRS can be distinguished on the basis of the presence of a specic ... Analysis of the kinetics of proteolysis of Mt- and Ec-GluRS Fig S9 Minimal models of the proteolytic events leading to fragments M1M5 of Mt-GluRS and E1-E3 of Ec-GluRS Fig S1...

Ngày tải lên: 07/03/2014, 03:20

... additional N -domain, homologous to the N-domains of ClpA or ClpB, and a linker domain homologous to, but half the size of, the linker domain of ClpB [19] The N-terminal region contains two 32-amino acid ... tuberculosis ClpC1 has an inherent ATPase activity and also functions like a chaperone in vitro Furthermore, we investigated the role of the N-termin...

Ngày tải lên: 23/03/2014, 06:20

... postinfection, we observed a marked difference between the number of CFUs of the wild-type strain and that of the PMM56 mutant strain in lungs and in the spleen (Fig 7A) Indeed, both strains ... cell envelope of M tuberculosis and to virulence [3–6] Nevertheless, their precise molecular mechanisms of action are still unknown, and the specific roles of...

Ngày tải lên: 23/03/2014, 09:20

... eht yb desuac raef dna ,]23,61[ gnildnah yb noissergga lacisyhp dna gnituohs dna ,]83,92,02[ slamina rof ytlevon a si nep gnildnah ehT sserts lanoitidda esopmi ]32,71,61,9[ gnildnah gnirud elpoep ... ,641-321.pp erafleW laminA rof snoitacilpmI dnA selpicnirP cisaB :ssertS slaminA fo ygoloiB ehT ).sde( AJ hcneM ,PG grebroM :nI sserts fo tnemerusaem ffo-sdnah dna no-sdnaH RL ,swehttaM...

Ngày tải lên: 07/08/2014, 18:21