Myocardial bridge (incidental finding or clinical pathology)

... Myocardial Bridges  Present in 30-80% of population by autopsy (

Ngày tải lên: 30/08/2015, 11:51

... ,ylerar ,dna ]7[ reddalb dna ,suretu ,anigav ,]2[ xidneppa ,]3[ enitsetni llams eht otni noitargim ot roirp enitsetni egral eht etarofrep ot msinagro siht rof elbissop si tI setuor cificeps lareves ... ytivitpac ni slamina ni msitisarap aivrel sugartommA gnidrager elbaliava yltnerruc si atad elttiL esaesid ciretne fo snoitatsefinam emos ni etanimluc yam dna ,etis noitartenep eht fo ytiniciv l...

Ngày tải lên: 07/08/2014, 18:21

... this article as: Tsigkas et al.: Heart echinococcus cyst as an incidental finding: early detection might be life-saving Journal of Cardiothoracic Surgery 2010 5:124 Submit your next manuscript to ... inotropic support Cytology of the aspirated cyst fluid and histology of the cyst wall was consistent with the diagnosis of hydatid cyst (Figure 7) The patient had an...

Ngày tải lên: 10/08/2014, 09:23

... 2C19intron5R TAACATTAGCAGGTGAAGCCCAAA CAATCTGTTCCATGATGGTTGATG AGACTGTGCTATCATGGGAACCAA GTTTTCTTGGGCTGAATGTCCTCT GGCAAGAAACACTTCATGAGCACT ATTCAGTTAAGGCCTCCCTTTTCC CAAGATGGGCCTTATAAAGTTGGC GAAGAAATTGGAACCCTCATGTCC ... Albumin/globulin ratio (A/ G) Alkaline aminotransferase (ALT) Alkaline phosphatase (ALP) Aspartate aminotransferase (AST) Bilirubin (total) (Bil) Calcium (Ca) Cholesterol (Chol)...

Ngày tải lên: 12/08/2014, 18:22

... pancreatectomy was attempted for three SPT patients in whom the mass was located in the portion of body or tail of the pancreas For tumors of SPT located in the neck and body of the pancreas, resection of ... analysis of solid- pseudopapillary tumor of the pancreas: report of 15 cases Hepatobilliary Pancreat Dis Int 2008;7(2):196-200 Yu CC, Yeh CN, Hwa...

Ngày tải lên: 25/10/2012, 11:40

... in the research phase In conclusion, chorioretinal involvement, frequently asymptomatic and self-limited, is present in almost 80% of patients with WNV infection associated with neurologic disease ... M, Ben Yahia S, Ladjimi A, et al Chorioretinal involvement in patients with West Nile virus infection Ophthalmology 2004;111:2065-70 Garg S, Jampol LM Systemic and intraocula...

Ngày tải lên: 03/11/2012, 11:17

... response on ILR monitoring Group 2= Patients without asystolic or bradycardic response on ILR monitoring Symptoms (Table and Figure 1) Aura or prodrome: Only thirteen percent of patients in group1 ... characteristics of patients with asystolic or bradycardic responses during ILR monitoring (Group 1) are compared with those without asystolic or brad...

Ngày tải lên: 03/11/2012, 11:17

... Forensic Pathology • Pathology is the study of disease and how that disease process effects man • Forensic pathology is the study of disease processes, ... Suicidal gunshot wounds Suicidal gunshot wounds Suicidal drug overdose Suicidal drug overdose Greenville County, South Carolina • Homicide, or death at the hands of another, made up 31 cases, or 2%, ... stroke (cereb...

Ngày tải lên: 24/03/2014, 11:20

... out a migrainous headache Therefore it is possible that some of the cases that were diagnosed and managed as sinusitis were attributable to migraine or migrainous headache More than 90% of headaches ... their headache using a scale from to 10 In addition, all study participants had a general medical and neurologic examination All this information was recorded on standa...

Ngày tải lên: 20/06/2014, 08:20

... significance of elevated Btype natriuretic peptide in patients with acute lung injury with or without right ventricular dilatation: an observational cohort study Annals of Intensive Care 2011 1:18 ... levels in ICU patients not change significantly [11,41] In summary, in patients with acute lung injury the plasma levels of BNP are...

Ngày tải lên: 21/06/2014, 03:20

... Myocardial Infarction and Left Ventricular Dysfunction, Heart Failure, or Both Sudden Death in Patients with Myocardial Infarction and Left Ventricular Dysfunction, Heart Failure, or Both On page ... studied 14,609 patients with left ventricular dysfunction, heart failure, or both after myocardial infarction to assess the...

Ngày tải lên: 27/06/2014, 00:20

... this article as: Kozma et al., Predicting hospital admission and discharge with symptom or function scores in patients with schizophrenia: pooled analysis of a clinical trial extension Annals of ... open-label extension of the three randomized clinical trials and who had usable scale scores and valid hospitalization dates were included in th...

Ngày tải lên: 08/08/2014, 23:21

... principal function of IL-10 appears to be anti-inflammatory, limiting and eventually terminating inflammatory responses by inhibiting synthesis of monocyte and macrophage derived pro-inflammatory cytokines ... injected intra-articularly into rabbit knees A naïve control group of rabbits was also included Lavages were performed using saline on days and after adenoviral delivery,...

Ngày tải lên: 09/08/2014, 08:22

... SScFib+, systemic sclerosis patients with functional lung fibrosis and signs of lung fibrosis on high-resolution computed tomography; SScFib-, SSc patients with no signs and symptoms of lung fibrosis ... superoxide; H2O2, hydrogen peroxide; NO, nitric oxide; SScFib+, systemic sclerosis patients with lung fibrosis; SScFib-, systemic sclerosis patien...

Ngày tải lên: 09/08/2014, 08:22

... facilitate the institution of an appropriate system Although the frequency of these lesions is low, they may have clinical significance and may be the first sign of life-threatening disease Researchers ... that potentially clinically significant lesions, incidental to the purpose of the imaging, are not missed There may be a number of ways of providing this funct...

Ngày tải lên: 09/08/2014, 10:22