THE EPR EFFECT(the enhanced permeability and retention effec

THE EPR EFFECT(the enhanced permeability and retention effect)

... DUNG Tổng quan EPR Cơ chế đặc điểm Các nhân tố điều chỉnh Ứng dụng điều trị ung thư công nghệ nano Hướng nghiên cứu tương lai TỔNG QUAN VỀ EPR EPR effect - Enhanced permeability and retention effect ... Prostaglandins  Superoxide, NO dẫn xuất chúng  ONOO (peroxynitrite) tạo thành phản ứng cực nhanh NO O2  VPF (VEGP)  Các protease  Các cytokines  Metalloproteinases Cơ chế ONO...

Ngày tải lên : 10/08/2015, 23:27

25
677
2

status of postnatal care among mothers giving birth at the two hospitals in hanoi and an effect evaluation of home-based postnatal care model

... mothers giving birth at the two hospitals in Hanoi and an effect evaluation of home-based postnatal care model" The research is aiming at the followings: Describing status of knowledge, practice and ... Promoting postnatal care knowledge among mothers could help them provide good practices of postnatal care While the need of po...

Ngày tải lên : 25/07/2014, 11:36

28
348
0

Báo cáo khoa học: "The incidence of recurrent flushing and its effect on branch production in Quercus petraea (Matt) Liebl growing in southern England" ppt

... water and nutrients for shoot extension and leaf expansion (Bond, 1945) Interpretation of the data for lateral branch production by sections of shoot formed during FIRST, SECOND and SPRING flushes ... showing flushes On those showing a single SPRING flush, branches will be concentrated at the tip of the annual increment in length whereas there will be centres of branchin...

Ngày tải lên : 08/08/2014, 23:22

9
324
0

Wheat germ agglutinin conjugated poly dl lactic co glycolic acid (PLGA) nanoparticles for enhanced uptake and retention of paclitaxel by colon cancer cells

... PLGA nanoparticles loaded with paclitaxel (WNP) could improve the delivery of paclitaxel to colonic cancer cells Glycosylation patterns of representative colon cancer cells (Caco-2 and HT-29 cells) ... cytotoxicity profile of blank WGA -conjugated PLGA nanoparticles against colon cells (a) positive and negative control; (b) Caco-2 cells; (c) HT-29 cells; (d...

Ngày tải lên : 14/09/2015, 08:37

231
349
0

Evaluating the australian ICT input substitution and productivity effects

... addressing the following questions: Is there productivity growth associated with more ICT- use and what are the input substitution effects on firms and industries? Is the increased use of ICT capital ... understanding of the substitution relationship between labour and ICT capital across the various industries We are hoping to gain insights to the changing in...

Ngày tải lên : 05/10/2015, 21:32

148
192
0

Globalization and its effects on the development of educational service in Vietnam

... education in Vietnam is an issue of rising importance Accordingly, I have conducted research on “ Globalization and its effects on the development of educational service in Vietnam Object and Field ... education service in Vietnam 2.1.4.1 The thought of education has changed 2.4.1.2 The impact of adhering to WTO on education service in Vie...

Ngày tải lên : 23/04/2013, 11:16

63
995
3

The effects of bottom up techniques in teaching listening skills to first year students at the university of fire fighting and prevention

... Investigating the effects of using bottom- up techniques in teaching listening to firstyear students; and - Formulating pedagogical implications and making suggestions for improving the teaching ... 2 The Effects of Bottom- up Techniques in Teaching Listening Skills to First Year Students at the University of Fire Fighting and...

Ngày tải lên : 07/09/2013, 13:48

46
1.2K
4

Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx

... trúc tài quan điểm Thông tin bất cân xứng cấu trúc tài Khung hoảng tài Khủng hoang tai 4/1/2009 Copyright © 2000 Addison Wesley Longman Slide #14-2 1.Cau trúc tai Cấu truc tài 2.Các quan điểm l a ... â xac đò h thơi gian Kiểm soát quản lý Slide #14-6 Các quan điểm l a chọn cấu trúc tài Một công ty tài trợ cho dự án mơi theo cac cach: cách: 1.Vay nợ 2.Huy Huy động cổ phần tư tài...

Ngày tải lên : 20/01/2014, 19:20

31
463
0

Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf

... addressing the reproductive and/ or developmental toxicities of these chemicals, and (d) they are of concern to the public The NTP has prepared an NTP-CERHR monograph for each phthalate This monograph ... doses of 0.1, 11, and 1,000 mg/kg, and the percentage of the oxidative derivative of the monoester and of MIDP at the same doses were, respecti...

Ngày tải lên : 13/02/2014, 10:20

147
858
0

Tài liệu Global Retail Lending in the Aftermath of the US Financial Crisis: Distinguishing between Supply and Demand Effects ppt

... evidence on the consumer, or retail side, using an experimental setting that enables us to directly distinguish between the demand and supply effects of the financial crisis Insofar as retail customers ... B The Demand for Loans after the Beginning of the Financial Crisis The main objective in this paper is to separate supply and demand effects...

Ngày tải lên : 16/02/2014, 10:20

51
451
0

Tài liệu Good Governance and Aid Effectiveness: The World Bank and Conditionality docx

... politics The Bank s understanding of good governance continues to reflect a concern over the effectiveness of the state rather than the equity of the economic system and the legitimacy of the power ... World Development Report 1997: The State in a Changing World (Washington DC: OUP for World Bank) _ 1994 Governance: The World Bank Experience (Washington, D...

Ngày tải lên : 16/02/2014, 12:20

22
450
0

Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx

... ***** A DISSERTATION ON THE MEDICAL PROPERTIES AND INJURIOUS EFFECT OF THE HABITUAL USE OF TOBACCO: READ, ACCORDING TO APPOINTMENT, BEFORE THE MEDICAL SOCIETY OF THE COUNTY OF ONEIDA, AT THEIR ... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materi...

Ngày tải lên : 17/02/2014, 22:20

29
586
0

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên : 18/02/2014, 11:20

15
635
0

Tài liệu Báo cáo Y học: The effects of low pH on the properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of maize (Zea mays) pot

... (1993) The eﬀect of cross-linking of the subunits of NADPH -protochlorophyllide oxidoreductase on the aggregational state of protochlorophyllide Photosynthetica 29, 205–218 Wiktorsson, B., Ryberg, ... The effect of the presence of the adenylates on the ability of POR-PChlide640 to undergo photoconversion was checked by comparing the efﬁciency of photoc...

Ngày tải lên : 22/02/2014, 04:20

11
637
0