A Generalized PI Sliding Mode and PWM Control of Switched Fractional Systems

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... functions of English adjectives. Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives. Chapter IV is to make a contrastive analysis between English adjectives ... in details about classification adjectives in terms of their semantic and syntactic functions of English adjectives as...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
A study on syntactic, semantic and pragmatic features of exaggeration in english and vietnamese

A study on syntactic, semantic and pragmatic features of exaggeration in english and vietnamese

... syntactic, semantic and pragmatic characteristics of English and Vietnamese exaggeration. . On this ground, the thesis analyzes the syntactic, semantic and pragmatic features of exaggeration in English ... RESEARCH QUESTIONS - What are the syntactic, semantic and pragmatic features of exaggeration in English and Vietnamese? - What ar...

Ngày tải lên: 26/11/2013, 13:16

13 1,6K 4
SIMULATION AND SPEED CONTROL OF  INDUCTION MOTOR DRIVES

SIMULATION AND SPEED CONTROL OF INDUCTION MOTOR DRIVES

... Simulation and Speed Control of Induction Motor Drives 2012 35 | P a g e CHAPTER 4 ANALYSIS OF VARIOUS METHODS FOR SPEED CONTROL OF IM The various methods of speed control of 3- Induction ... squirrel-cage motors where cost is an important criterion and efficiency is not. However, this method has rather limited range of speed control. S...

Ngày tải lên: 18/12/2013, 22:06

76 684 0
A first course in fuzzy and neural control

A first course in fuzzy and neural control

... on mathematical models, and in the remainder of this book, we explore possible alternatives to a rigid mathematical model approach. These alternative approaches – fuzzy, neural, and combinations ... the vast number of technical papers appearing in journals and conference proceedings in all areas of engi- neering, manufacturing, sciences, medicine, and business. Soft computin...

Ngày tải lên: 01/01/2014, 17:41

306 638 0
Analysis and control of nonlinear process systems

Analysis and control of nonlinear process systems

... Notions of Systems and Signals Signals and systems are basic notions of systems and control theory. There- fore, we briefly summarize the most important concepts of the mathematical description of ... almost all process systems are nonlinear in nature. Therefore advanced process control should necessarily use nonlinear con- trol techniques. 1.1 A Brief Overvie...

Ngày tải lên: 01/01/2014, 18:38

335 375 1
Tài liệu Social and Economic Control of Alcohol The 21st Amendment in the 21st Century docx

Tài liệu Social and Economic Control of Alcohol The 21st Amendment in the 21st Century docx

... explanation without intent to infringe. Library of Congress Cataloging in Publication Data Jurkiewicz, Carole L., 1958‑ Social and economic control of alcohol : the 21st amendment in the 21st century / ... attempts at controlling overindulgence, acting in response to the demands of AU5463.indb 2 10/5/07 1:42:15 PM 10  n  Social and Economic Control of Alco...

Ngày tải lên: 15/02/2014, 19:20

264 749 1
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... GGGTTCT AACAAG GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3Â. The ... according to the manufacturer’s guidelines and using the following primers: Aba, 5Â-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT GGTGT...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

... unavoidably deleted AT-rich LIRs, and some of them have been implicated as the mediator of constitutional t(11;22) translocation in humans [38]. Although there are also a large number of (CA) n and (GA) n repeats ... the transcriptional response [23]. Many studies also show that inverted repeats are essential for the initiation of DNA replication in plas- mids, bacteria, e...

Ngày tải lên: 07/03/2014, 00:20

13 542 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5Â-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3Â and antisense primer 5Â-GAAT GCGGCCGCTCAGTCCTGCTC ... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5Â-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3Â) and antisense primer SOE-4 (5Â-GAAT GCGGCCGCTTACT TGTAACAGCTCGTCCATG-3Â)...

Ngày tải lên: 07/03/2014, 21:20

11 668 0
Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems " doc

Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems " doc

... at the Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam National ... combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems N.D. Anh *...

Ngày tải lên: 28/03/2014, 13:20

8 360 0
Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems" doc

Báo cáo " A combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems" doc

... proposes a combination of the identification algorithm and the modal superposition method for feedback active control of incomplete measured systems. The system is expanded to the N.D. Anh, L.D. ... complete measured systems. The aim of this paper is to present a combination of the identification algorithm and the modal super...

Ngày tải lên: 28/03/2014, 13:20

8 417 0
Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps

Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps

... Furthermore, the subsequent emergence of the Th1–Th2 paradigm seemed largely able to subsume suppression phenom- ena by the patterns of regulatory cytokines that these cells could secrete, and the ... isolating the T lymphocyte fraction that harboured regulatory activity. Sakaguchi and col- leagues managed to first identify the CD5 molecule as a marker for T R c...

Ngày tải lên: 09/08/2014, 01:23

7 576 0
A Generalized PI Sliding Mode and PWM Control of Switched Fractional Systems

A Generalized PI Sliding Mode and PWM Control of Switched Fractional Systems

... the controlled signals. 5APWMΣ − Δ Modulation GPI Control Approach The control of switched systems via PWM actuators constitutes a vast area of applications with a sufficient number of theoretical ... implications of fractional calculus in the modeling and control of physical systems of various kinds is well known and documented in the control systems an...

Ngày tải lên: 01/07/2015, 09:18

21 345 0
w