Architecture and Construction A.Ali C.A.Brebbia
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc
... Division of Monetary Affairs, Federal Reserve Board E-mail: william.b.english@frb.gov † Division of Research & Statistics, Federal Reserve Board E-mail: skander.j.vandenheuvel@frb.gov ‡ Division of Monetary ... Exposure and the Interest Rate and Exchange Rate Risks of U.S Banks,” Journal of Financial Services Research, 12, 267–286 Demsetz, R S and P E...
Ngày tải lên: 17/02/2014, 03:20
Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf
... the larvae are hatched and as the juvenile seahorses are preparing to leave the pouch This suggests the passage of a signal between the young and the father which regulates the levels of synthesis ... of We have created and partially characterized a cDNA library comprising genes expressed in the epithelium and stroma-like tissue lining the male seahorse br...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc
... the boundary effect of the R3 pair bound to L1 and L2 Turning a gene into an active state from a state of inactivation often involves binding of a single activator molecule to its site in a repressive ... chromatin structure [37] Thus, the binding of proteins at singular sites in an array of densely packed and equally spaced nucleosomes can cause substantial...
Ngày tải lên: 16/03/2014, 10:20
symbolic space french enlightenment architecture and its legacy by richard a etlin
... the neoclassical facade for his proposed Palais National." The Palais National was a huge temple to the revolution and the people of France, and furthermore, it was to have a functional purpose ... contexts Fascist Italy, Nazi Germany, and Hussein's Iraq are some of Etlin' s examples One legacy from revolutionary space is the concept of size and enormity Iraq's "Victory Arch"...
Ngày tải lên: 21/03/2014, 22:51
Media Gateway control protocol architecture and requirements Nancy Greene, Michael A. Ramalho, Brian Rosen pdf
... proper Media Control MIB requirements and on the requirements for discovery.] General Protocol Requirements The protocol must: Greene, Ramalho, Rosen Internet draft MG control protocol requirements ... scope of the general Media Gateway control protocol The protocol must support all types of bearer types listed in Table Greene, Ramalho, Rosen Intern...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... platinum, but not nuclease hypersensitive elements of human c-myc and PDGF-A promoters; the abundance of unfolded DNA is proportional to the platinum concentration Results CD spectrum of G-rich oligonucleotides ... my student Lubos Bauer and Professor Viktor Brabec for the opportunity to work in his laboratory and obtain skills with respect to DNA platination...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
... EMSA For radioactive EMSA, yeast tRNASer transcript was generated and purified as before [54] The tRNA transcript was charged with [14C]l-serine, and the aminoacylation plateau was measured with ... trans, also appears to lack specific tRNA recognition capability [45], but, like Pex21p, forms a binary complex with the corresponding synthetase (ProRS) and a te...
Ngày tải lên: 23/03/2014, 09:20
Tutorial Final and Construction Stage Analysis for a Cable-Stayed Bridge potx
... Stage Analysis Construction stage analysis for a cable-stayed bridge can be classified into forward analysis and backward analysis, based on the analysis sequence Forward analysis reflects the real ... Stage Analysis 42 FINAL AND CONSTRUCTION STAGE ANALYSIS FOR CABLE-STAYED BRIDGES We will generate a construction stage analytical model using...
Ngày tải lên: 24/03/2014, 06:20
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGT...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly rando...
Ngày tải lên: 31/03/2014, 09:20