... in developing a migration strategy is to select an appropriate migration path to the Microsoft® Windows 2000 Active Directory directory service Selecting a migration path can be a complex decision, ... selecting a migration path is to identify and prioritize your migration goals Your migration goals can relate to business or the migration itself Exa...
Ngày tải lên: 18/01/2014, 05:20
... 156 0–1 567 Schapira AH (2008) Mitochondria in the aetiology and pathogenesis of Parkinson’s disease Lancet Neurol 7, 9 7–1 09 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Saito M, Maruyama M, Takahashi ... recessive genes in Parkinson’s disease contains a putative catalytic serine–threonine kinase domain and shares homology with calmodulin-dependant protein kinase In...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: Phosphorylation of NF-jB proteins by cyclic GMP-dependent kinase A noncanonical pathway to NF-jB activation potx
... from the NIH AIDS Reagent Repository) was Flag-tagged at the 5¢-end by PCR using the primers 5¢-CTGCAGCATGGACTACAAGGACGACGA TGACAAGGAGAGTTGCTACAACCCAGGTCTG-3¢ and 5¢-GAGAGTTGCTACAACCCAGGTCTG-3¢ ... 5¢-GCGGCGGCCTGCCGACCGG GAGCTCAGT-3¢ for S27 6A and 5¢-AAACGTAAAAG GGCATATGAGACCTTCAAGAGCATC-3¢ for T30 5A (mutations in bold) The accuracy of the mutations was confirmed by DNA sequencing p4...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Glycoprotein Ib-mediated platelet activation A signalling pathway triggered by thrombin doc
... to thrombin and upstream of aIIbb3 activation GPIb plays an important role in platelet activation by low thrombin concentrations and therefore at the start of the haemostasis process when trace ... PPACKthrombin and is involved in platelet platelet interactions, in agreement with the observations of Ramakrishnan et al [11] using GPV null mouse platelets In contrast, platelet...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx
... GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC ... GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGA...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
... x-hydroxylate the saturated FAs lauric acid, myristic acid (tetradecanoic acid) , palmitic acid (hexadecanoic acid) and the unsaturated FAs oleic acid [(Z)-octadec-9-enoic acid] and arachidonic acid (all-cis-5,8,11,14-eicosatetraenoic ... Mitochondrial b -oxidation and x -oxidation In the case of mitochondrial FA b -oxidation disorders, there is accumulation of certain FAs e...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx
... probably not an essential one Identification of a putative proton pathway in Neurospora crassa H+-ATPase The chemiosmotic model for PMA1_NEUCR In the P-type proton pumps, the origin of the transported ... ATP hydrolysis were built for plant and yeast H+-ATPases on the basis of the ACT1_RABIT crystal structure [9] From these models is was proposed that p...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...
Ngày tải lên: 29/03/2014, 21:20
Lay a pebble path
... 3: Base course Add a layer of GAP 20 base course in between the edging boards (GAP 20 is a mixture of rock The abbreviation, GAP 20, General All Passing, means the metal is graded to one certain ... boards At the same time compact the soil against the outside of the edge boards thus ensuring they stay in place parellel You can hire a plate vibrator from your local hire centre Step 4: L...
Ngày tải lên: 14/04/2014, 11:38
báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc
... study and at the data acquisition followed by data preparation for the current analysis RP participated at data acquisition and data preparation for the current analysis TU participated in the ... t-1 was used as additional covariate The last analysis was focused on the association between health factors and participation This result has to be taken into account for the discussion o...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Minimum-length scheduling with rate control in wireless networks: a shortest path approach" docx
... source-destination pair on a DAG We obtain an optimal joint scheduling and rate control solution that provides a shortest path Although finding a shortest path on a DAG has a polynomial complexity in the number ... list with the most commonly appearing variables in the paper to facilitate the reader The variables are listed in the order they appear in Table b...
Ngày tải lên: 20/06/2014, 22:20
True North Groups A Powerful Path to Personal and Leadership Development BK Business_1 doc
... Finding Your True North: A Personal Guide (2008) (with Andrew McLean and Nick Craig) Lessons for Leading in Crisis (2009) TRUE NORTH GROUPS A Powerful Path to Personal and Leadership Development ... groups and that they are part of a broader societal shift toward forming small groups Thus, we expanded our focus to looking at the essential role True...
Ngày tải lên: 21/06/2014, 12:20
True North Groups A Powerful Path to Personal and Leadership Development BK Business_2 pptx
... offers a place to refine your authentic approach to leading and to sharpen your skills as a facilitator As one interviewee observed, these groups are a place to get frequent, 360-degree feedback ... have all the answers We all have more questions than answers 22 true north groups It wasn’t always this way It took a number of years to let go of our egos and to be...
Ngày tải lên: 21/06/2014, 12:20