Strategy development phase of five years (2010-1015) of the SOTRACO
The Local Benefits of Global Air Pollution Control in Mexico City - Final Report of the Second Phase of the Integrated Environmental Strategies Program in Mexico ppt
... 2003, the Second Phase of the Integrated Environmental Strategies Program in Mexico was undertaken at the Instituto Nacional de Ecología (INE; National Institute of Ecology) of Mexico In this report, ... decision- makers and their staffs in Mexico City There is interest from these groups in applying the model to their work and in modifying it for use in other regions of Mexico, particularly the City ... -6 3.37 -5 9.59 -5 5.95 -5 2.44 -4 8.79 -4 5.58 -4 2.53 -3 9.65 -3 7.16 84.39 64.82 45.53 27.20 20.18 -7 9.56 -7 5.29 -7 1.31 -6 7.28 -6 3.37 -5 9.59 -5 5.95 -5 2.44 -4 8.79 -4 5.58 -4 2.53 -3 9.65 -3 7.16 Table III.2.7...
- 175
- 558
- 1
báo cáo hóa học: " Hypoxia silences the neural activities in the early phase of the phrenic neurogram of eupnea in the piglet" docx
... for the early and late phases of the phrenic neurogram during eupnea as well as the phrenic burst during gasping were estimated The mean ratios for the early, late phase during eupnea and gasping ... not influence phrenic neurons responsible for the neural activities in the late phase of the phrenic neurogram during inspiration In addition, it also significantly increases the duration of the ... disappeared during the early phase of the phrenic neurogram although the burst activity and the continuous activity remained, but both them appear at the late phase of the phrenic neurogram as maturation...
- 9
- 514
- 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... concluded that the first session of TOT training has built up trainees’ confidence in using weaver ants as a major component of the cashew IPM program A TOT training report is attached at the end of this ... acceptable by cashew farmers who participated in this training Therefore, the first session of training has already built up trainees confidence in using weaver ants as a major component of the ... Institute Information Project Name Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam Vietnamese Institution Institute of Agricultural Science...
- 10
- 327
- 1
báo cáo khoa học: " A rice calcium-dependent protein kinase is expressed in cortical root cells during the presymbiotic phase of the arbuscular mycorrhizal symbiosis" pps
... a characteristic structure consisting of four domains: an amino terminal variable domain, a serine/threonine kinase domain, a junction autoinhibitory domain, and a C-terminal calmodulin domain ... 5’-CGGGGATCCATGAGTAAAGGAGAAGAACTTTTCAC-3’ (forward) and 5’CCGAGCTCTTATTATTTGTATAGTTCATCCATGC3’ (reverse) During the PCR reaction, BamHI and SacI sites were introduced into the PCR amplified DNA fragment ... their activation Ca2+ binds directly the calmodulin domain of CPKs and induces a conformational change resulting in kinase activation [34] The available information on plant CPKs from various plant...
- 14
- 723
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 1 ppsx
... dropped 14 Is deflation a danger for Europe and the United States? 15 10 C O N T E N T S 1. 12 1. 13 1. 14 1. 15 1. 16 1. 17 1. 18 1. 19 1. 20 1. 21a 12 1b 1. 21c 1. 22 1. 23 1. 24 1. 25 1. 26 1. 27 1. 28 1. 29 1. 30 1. 31 ... 10 Agricultural exports (%) 19 81 1982 19 83 19 84 19 85 19 86 19 87 19 88 19 89 19 90 19 91 1992 19 93 19 94 19 95 19 96 19 97 19 98 19 99 2000 20 01 In low-income countries, manufactures make up 80 percent of ... 19 90 19 91 1992 19 93 19 94 19 95 19 96 19 97 19 98 19 99 2000 20 01 Source: UN COMTRADE to date have freed up only 15 percent of the quotas, obliging them to implement major changes at the end of the...
- 34
- 222
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 2 pps
... 0.8 2. 4 1.5 1.5 2. 2 0.8 0.7 2. 1 2. 5 2. 5 3.4 1.3 1.7 4.1 2. 4 2. 3 2. 8 1.3 2. 1 4.4 1.9 1.8 2. 5 0.6 1.4 3.0 2. 9 2. 8 3.5 1.6 2. 6 4.3 2. 9 5.5 2. 2 0.3 3 .2 2.9 3.8 4.9 3 .2 3.3 6.7 4.6 –0.8 3.1 3 .2 2.8 ... 12 /0 5/ 2/ 5/ 02 22 / 6/ 02 11 /0 7/ 1/ 7/ 21 /0 8/ 10 / 8/ 02 30 / 9/ 02 19 / 10 02 /9 10 / 02 /2 11 / 02 /1 12 / 02 /8 12 / 02 /2 8/ 1/ 02 17 /0 2/ 6/ 2/ 26 / 3/ 03 18 /0 4/ 7/ 4/ 27 /0 400 Source: ... 1.5 8 .2 26.0 4.3 5.6 2. 3 21 .0 –19 .2 –0.1 3.5 4 .2 1.8 3.4 1.0 2. 1 2. 0 2. 1 3.8 3.1 1.7 2. 4 3 .2 2.3 1.3 2. 3 1.9 3.0 2. 0 3.1 3.0 3.9 2. 9 3.8 2. 3 3 .2 3 .2 4.1 0.9 1.0 0.3 0.4 1.5 –1.1 1.6 1.6 2. 4 0.1...
- 33
- 258
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 3 ppt
... 1.2 3. 6 100.0 16.5 16.9 16.9 28.7 13. 5 13. 2 9.1 7.1 12.0 15.9 7.4 18.1 23. 3 8.5 22.6 39 .3 5.2 11.8 9.5 11.6 70.5 8.8 9.5 2.5 1.0 0.2 2.9 0.8 3. 9 100.0 35 .9 18 .3 32.8 1 .3 3.6 2 .3 1 .3 1.2 3. 2 100.0 ... 57.9 3. 2 5.5 0.6 1 .3 23. 5 3. 9 0 .3 3.9 100.0 8.8 4.1 26.0 13. 1 4.0 18.7 16.4 –4.2 6.4 9.9 20.8 46.2 33 .7 11.5 21.2 57.5 4.6 20.7 22.0 22.8 63. 6 0 .3 3.4 1.7 0.8 2.6 24.8 –0 .3 3.1 100.0 56.4 3. 5 ... 1,114 819 295 31 121 50 1,010 38 6 897 627 269 96 132 68 1,128 480 33 9 219 120 45 117 62 1, 139 618 1,094 800 295 31 121 50 971 38 6 8 73 599 2 73 101 136 72 1,052 504 35 4 256 98 48 124 38 968 612 Total...
- 33
- 274
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 4 potx
... 31.0 24. 2 42 .1 23.0 16.6 26.7 33.3 30.3 36 .4 36.0 43 .4 34. 6 20.3 43 .7 15.5 23.8 14. 8 14. 9 13.7 14. 4 20.1 45 .3 55.3 50.3 76 .4 41.1 39.1 65 .4 38 .4 34. 2 29.7 31.8 27.7 30.9 16 .4 19.0 12.7 24. 7 18.9 ... Venezuela 163 54 40 28 34 n/a n/a 33 64 256 47 28 269 42 75 n/a 40 n/a 36 119 n/a 30 116 328 16 64 41 50 40 n/a n/a 45 91 10 256 56 65 345 42 330 n/a 63 n/a 47 119 n/a 49 119 62 20 38 42 27 53 29 ... 2.0 2.3 3.2 0.6 0.6 10.8 0.6 0.7 0 .4 5.0 5.6 13.9 14. 8 44 .4 28.2 4. 8 19.1 4. 7 0 .4 1 .4 1.6 7.5 4. 0 0.6 2.1 1 .4 1.9 1.0 1.8 10.0 2.7 53.6 62.3 55.6 47 .3 47 .4 71 .4 53.3 100 100 100 100 100 100 100...
- 33
- 212
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 5 ppsx
... 15. 3 63.9 14.7 12.9 238.0 50 6.3 50 .0 350 .0 917.0 55 .0 154 .0 170.0 25. 0 376 .5 20.0 15. 0 12.9 27.3 10.0 26.2 119.2 5. 9 17.4 24.1 9.1 68.2 6 .5 3.7 76.0 85. 9 85. 5 99.3 98.0 100.0 100.0 100.0 100.0 ... 10.1 5. 2 8.0 6.0 18.8 0 .5 9.7 30.6 0.0 0.2 15. 3 5. 0 5. 0 12.3 0.0 7.0 21.7 18.9 30.4 36.4 2.0 13.8 20.1 a 19.3 50 .0 25. 5 11.6b a 9.2 13.3 22 .5 4.6 5. 5 10.2 49.6 30.0 41.9 8.7 13.2 16.7 9.9 18 .5 18.0 ... 13.2 16.7 9.9 18 .5 18.0 4.4 4.4 6 .5 1 35. 4 52 .2 34.1 5. 0 10.6 11.6 11 .5 5.1 16.2 0.6 3.2 3 .5 15. 6 5. 8 20.0 4.9 4.3 9.1 a All lines are specific b 56 percent of lines are specific Source: WTO Integrated...
- 33
- 314
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 6 docx
... 2,242 .6 369 .0 60 0.5 3,005.3 1.2 6, 319 .6 9, 769 .6 2,9 06. 5 25,214.3 870.2 65 .6 168 .9 1,391.3 1.0 3, 866 .9 3 ,66 2.0 939.9 10, 965 .7 1 06. 7 0.0 0.4 0.7 0.1 0.0 2,408.5 855.8 3,372.1 763 .4 65 .6 168 .5 1,390 .6 ... change Realizing the development promise of the Doha Agenda will require the international community to tackle some of the most difficult problems of agricultural trade Agriculture remains one of the ... economic area United States 30 5 16 1 36 26 13 3 26 105 12 36 26 427 57 Acquisitions of nationality Australia Canada European economic areaf Japan United States 107 130 460 12 315 102 160 69 0 16...
- 33
- 269
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 7 doc
... through the movement of software engineers to the site of the consumer And with greater liberalization of barriers to the movement of people, many more developing countries could “export” at least the ... section of the chapter draws heavily on “Service providers on the move: economic impact of Mode 4” prepared by Olivier Cattaneo and Julia Nielson of the OECD Secretariat for the Trade Committee of the ... entailing the supply of a service by a service supplier of one Member, through presence of natural persons of a Member in the territory of any other Member.” The Annex on Movement of Natural...
- 33
- 231
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 8 docx
... 1995 1996 1997 19 98 1999 2000 2001 Dutiable imports 4 48 539 585 575 543 5 48 623 588 283 331 351 346 311 290 3 08 296 Rate of use of preferences (percent) 83 1 08 100 100 74 68 72 71 Total imports ... diversification of the export base Extending the liberal rules of origin under AGOA would help reduce the impact of the abolition of the remaining import quotas on textiles and clothing The available ... countries with preferences of the erosion in preferential access of other countries—especially members 2 18 of free-trade agreements—and, as noted earlier, of the impact of rules of origin As MFN tariffs...
- 33
- 256
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 9 ppsx
... (percent) 197 0 198 0 199 0 2000 2001 2002 197 0–80 198 0 90 199 0–00 Grains Production Consumption Exports Stocks 1,0 79 1,114 1 19 193 1,430 1,451 212 3 09 1,7 69 1,717 206 490 1,8 39 1,862 233 536 1,872 1 ,90 2 ... 198 0 199 0 199 9 2000 2001 197 0–80 198 0 90 199 0–00 Coffee (Thousand bags) Production Consumption Exports 64,161 71,536 54,186 86,174 79, 100 60 ,99 6 100,181 96 ,300 76,163 116,581 106,343 90 , 394 110,104 ... in 2002 (figure A2.5) They are exilogram Table A2.5 Global grain stocks-to-use percentages (excluding China) Maize 199 7 98 199 8 99 199 9–00 2000–01 2001–02 2002–03 2003–04 90 s Low Rice Wheat Total...
- 33
- 386
- 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 10 doc
... 170.4 170.5 132.7 100 .3 154.8 163.6 119.5 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 28.05 78.81 10. 88 33.59 65.93 6.98 Inflation indices, 1990 =100 d MUV indexe ... 104 .6 79.0 122.0 128.9 94.2 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 123.4 86.9 87.7 88.4 84.5 96.2 79.5 77.7 91.4 111.0 78.0 105 .8 83.0 Constant 1990 dollarsc ... 219.3 109 .3 270.9 103 .9 135.5 91.0 208.0 90.4 117.2 102 .9 198.9 105 .5 153.5 109 .6 205.7 109 .6 147.8 103 .8 209.6 103 .8 140.1 97.1 209.5 97.1 132.8 102 .6 215.1 102 .6 141.7 104 .8 215.1 104 .8 145.0 Other...
- 36
- 242
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP