Strategy development phase of five years (2010-1015) of the SOTRACO

The Local Benefits of Global Air Pollution Control in Mexico City - Final Report of the Second Phase of the Integrated Environmental Strategies Program in Mexico ppt

The Local Benefits of Global Air Pollution Control in Mexico City - Final Report of the Second Phase of the Integrated Environmental Strategies Program in Mexico ppt

... 2003, the Second Phase of the Integrated Environmental Strategies Program in Mexico was undertaken at the Instituto Nacional de Ecología (INE; National Institute of Ecology) of Mexico In this report, ... decision- makers and their staffs in Mexico City There is interest from these groups in applying the model to their work and in modifying it for u...

Ngày tải lên: 29/03/2014, 14:20

175 558 1
báo cáo hóa học: " Hypoxia silences the neural activities in the early phase of the phrenic neurogram of eupnea in the piglet" docx

báo cáo hóa học: " Hypoxia silences the neural activities in the early phase of the phrenic neurogram of eupnea in the piglet" docx

... for the early and late phases of the phrenic neurogram during eupnea as well as the phrenic burst during gasping were estimated The mean ratios for the early, late phase during eupnea and gasping ... not influence phrenic neurons responsible for the neural activities in the late phase of the phrenic neurogram during inspiration In addition, i...

Ngày tải lên: 19/06/2014, 10:20

9 514 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

... concluded that the first session of TOT training has built up trainees’ confidence in using weaver ants as a major component of the cashew IPM program A TOT training report is attached at the end of this ... acceptable by cashew farmers who participated in this training Therefore, the first session of training has already built up trainees confidenc...

Ngày tải lên: 21/06/2014, 06:20

10 327 1
báo cáo khoa học: " A rice calcium-dependent protein kinase is expressed in cortical root cells during the presymbiotic phase of the arbuscular mycorrhizal symbiosis" pps

báo cáo khoa học: " A rice calcium-dependent protein kinase is expressed in cortical root cells during the presymbiotic phase of the arbuscular mycorrhizal symbiosis" pps

... a characteristic structure consisting of four domains: an amino terminal variable domain, a serine/threonine kinase domain, a junction autoinhibitory domain, and a C-terminal calmodulin domain ... 5’-CGGGGATCCATGAGTAAAGGAGAAGAACTTTTCAC-3’ (forward) and 5’CCGAGCTCTTATTATTTGTATAGTTCATCCATGC3’ (reverse) During the PCR reaction, BamHI and SacI sites were introduced into the PCR...

Ngày tải lên: 11/08/2014, 11:20

14 723 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 1 ppsx

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 1 ppsx

... dropped 14 Is deflation a danger for Europe and the United States? 15 10 C O N T E N T S 1. 12 1. 13 1. 14 1. 15 1. 16 1. 17 1. 18 1. 19 1. 20 1. 21a 12 1b 1. 21c 1. 22 1. 23 1. 24 1. 25 1. 26 1. 27 1. 28 1. 29 1. 30 1. 31 ... 10 Agricultural exports (%) 19 81 1982 19 83 19 84 19 85 19 86 19 87 19 88 19 89 19 90 19 91 1992 19 93 19 94 19 95 19 96...

Ngày tải lên: 14/08/2014, 22:21

34 222 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 2 pps

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 2 pps

... 0.8 2. 4 1.5 1.5 2. 2 0.8 0.7 2. 1 2. 5 2. 5 3.4 1.3 1.7 4.1 2. 4 2. 3 2. 8 1.3 2. 1 4.4 1.9 1.8 2. 5 0.6 1.4 3.0 2. 9 2. 8 3.5 1.6 2. 6 4.3 2. 9 5.5 2. 2 0.3 3 .2 2.9 3.8 4.9 3 .2 3.3 6.7 4.6 –0.8 3.1 3 .2 2.8 ... 12 /0 5/ 2/ 5/ 02 22 / 6/ 02 11 /0 7/ 1/ 7/ 21 /0 8/ 10 / 8/ 02 30 / 9/ 02 19 / 10 02 /9 10 / 02 /2 11 / 02 /1 12 / 02 /8 12 / 02 /2 8/ 1/ 02 17...

Ngày tải lên: 14/08/2014, 22:21

33 259 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 3 ppt

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 3 ppt

... 1.2 3. 6 100.0 16.5 16.9 16.9 28.7 13. 5 13. 2 9.1 7.1 12.0 15.9 7.4 18.1 23. 3 8.5 22.6 39 .3 5.2 11.8 9.5 11.6 70.5 8.8 9.5 2.5 1.0 0.2 2.9 0.8 3. 9 100.0 35 .9 18 .3 32.8 1 .3 3.6 2 .3 1 .3 1.2 3. 2 100.0 ... 57.9 3. 2 5.5 0.6 1 .3 23. 5 3. 9 0 .3 3.9 100.0 8.8 4.1 26.0 13. 1 4.0 18.7 16.4 –4.2 6.4 9.9 20.8 46.2 33 .7 11.5 21.2 57.5 4.6 20.7 22.0 22.8 63. 6 0 .3 3.4 1.7 0.8...

Ngày tải lên: 14/08/2014, 22:21

33 274 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 4 potx

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 4 potx

... 31.0 24. 2 42 .1 23.0 16.6 26.7 33.3 30.3 36 .4 36.0 43 .4 34. 6 20.3 43 .7 15.5 23.8 14. 8 14. 9 13.7 14. 4 20.1 45 .3 55.3 50.3 76 .4 41.1 39.1 65 .4 38 .4 34. 2 29.7 31.8 27.7 30.9 16 .4 19.0 12.7 24. 7 18.9 ... Venezuela 163 54 40 28 34 n/a n/a 33 64 256 47 28 269 42 75 n/a 40 n/a 36 119 n/a 30 116 328 16 64 41 50 40 n/a n/a 45 91 10 256 56 65 345 42 330 n/a 63 n/a 47...

Ngày tải lên: 14/08/2014, 22:21

33 212 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 5 ppsx

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 5 ppsx

... 15. 3 63.9 14.7 12.9 238.0 50 6.3 50 .0 350 .0 917.0 55 .0 154 .0 170.0 25. 0 376 .5 20.0 15. 0 12.9 27.3 10.0 26.2 119.2 5. 9 17.4 24.1 9.1 68.2 6 .5 3.7 76.0 85. 9 85. 5 99.3 98.0 100.0 100.0 100.0 100.0 ... 10.1 5. 2 8.0 6.0 18.8 0 .5 9.7 30.6 0.0 0.2 15. 3 5. 0 5. 0 12.3 0.0 7.0 21.7 18.9 30.4 36.4 2.0 13.8 20.1 a 19.3 50 .0 25. 5 11.6b a 9.2 13.3 22 .5 4.6 5. 5 10.2 49.6 30....

Ngày tải lên: 14/08/2014, 22:21

33 314 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 6 docx

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 6 docx

... 2,242 .6 369 .0 60 0.5 3,005.3 1.2 6, 319 .6 9, 769 .6 2,9 06. 5 25,214.3 870.2 65 .6 168 .9 1,391.3 1.0 3, 866 .9 3 ,66 2.0 939.9 10, 965 .7 1 06. 7 0.0 0.4 0.7 0.1 0.0 2,408.5 855.8 3,372.1 763 .4 65 .6 168 .5 1,390 .6 ... change Realizing the development promise of the Doha Agenda will require the international community to tackle some of the most difficult...

Ngày tải lên: 14/08/2014, 22:21

33 269 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 7 doc

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 7 doc

... through the movement of software engineers to the site of the consumer And with greater liberalization of barriers to the movement of people, many more developing countries could “export” at least the ... section of the chapter draws heavily on “Service providers on the move: economic impact of Mode 4” prepared by Olivier Cattaneo and Julia Nielson of the OECD...

Ngày tải lên: 14/08/2014, 22:21

33 231 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 8 docx

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 8 docx

... 1995 1996 1997 19 98 1999 2000 2001 Dutiable imports 4 48 539 585 575 543 5 48 623 588 283 331 351 346 311 290 3 08 296 Rate of use of preferences (percent) 83 1 08 100 100 74 68 72 71 Total imports ... diversification of the export base Extending the liberal rules of origin under AGOA would help reduce the impact of the abolition of the remaining import quotas on...

Ngày tải lên: 14/08/2014, 22:21

33 256 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 9 ppsx

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 9 ppsx

... (percent) 197 0 198 0 199 0 2000 2001 2002 197 0–80 198 0 90 199 0–00 Grains Production Consumption Exports Stocks 1,0 79 1,114 1 19 193 1,430 1,451 212 3 09 1,7 69 1,717 206 490 1,8 39 1,862 233 536 1,872 1 ,90 2 ... 198 0 199 0 199 9 2000 2001 197 0–80 198 0 90 199 0–00 Coffee (Thousand bags) Production Consumption Exports 64,161 71,536 54,186 86,174 79, 100 60 ,99 6 100,181 96 ,300 7...

Ngày tải lên: 14/08/2014, 22:21

33 386 0
Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 10 doc

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 10 doc

... 170.4 170.5 132.7 100 .3 154.8 163.6 119.5 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 28.05 78.81 10. 88 33.59 65.93 6.98 Inflation indices, 1990 =100 d MUV indexe ... 104 .6 79.0 122.0 128.9 94.2 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 100 .0 123.4 86.9 87.7 88.4 84.5 96.2...

Ngày tải lên: 14/08/2014, 22:21

36 242 0
Từ khóa:
w