0
  1. Trang chủ >
  2. Thạc sĩ - Cao học >
  3. Khoa học tự nhiên >

investigation the heavy metal contents in surface water and sediment collected in thadluang marsh

The role of language in adult education and poverty reduction in Botswan

The role of language in adult education and poverty reduction in Botswan

... disseminate information, encourage participation in the education and economy of the communities. To achieve its goal of disseminating useful information and eradicating poverty the adult education ... (medium of instruction) reflects the interests of those elite. In countries in which one of the languages dominate, there is usually an issue about where to place other languages in the education ... London, Longman. Rachal J R (1989), The social context of adult and continuing education, in Merriam S B and Cunningham P M (eds) Handbook of adult and continuing education, San Francisco, Jossey–Bass...
  • 5
  • 836
  • 1
arsenic contamination in soils, water and plants

arsenic contamination in soils, water and plants

... 0.3 mg/kg in plants and 0.001-0.01 mg/l in surface water. Contamination in soils and plants were found higher much larger than those in surface water flown from the tailing of gold mining disposal ... management in near future, the samples of top soils, water and plants were collected from the surrounding area of Gold Mine, within watershed covering gold mine and nearby watershed, to conduct the contamination ... 1 Arsenic contamination in soils, water and plants surrounding gold mine in Thailand Thares Srisatit1, Wanpen Wirojanagud2, Thanes Weerasiri3 1 Faculty of Environmental Engineering,...
  • 17
  • 693
  • 0
Tài liệu Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam pptx

Tài liệu Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam pptx

... for the ground water samples in An Binh and Hoa An in mmol(eq%)/l 1 Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam – exemplary investigations ... the rural areas of the Mekong Delta. The goal of the survey was the appraisal of the water resources in terms of quality and availability in or-der to develop a concept for the rural drinking ... Availability and Quality of Groundwater Resources, Ministry of Industry, Department of Geology and Minerals Divi-sion of Hydrogeology and Engineering Geology for the South of Vietnam (DHES), Ho Chi Minh...
  • 17
  • 694
  • 0
Tài liệu Environmental impacts of petroleum production: Fate of inorganic and organic chemicals in produced water from the Osage-Skiatook Petroleum Environmental Research sites, Osage County, Oklahoma doc

Tài liệu Environmental impacts of petroleum production: Fate of inorganic and organic chemicals in produced water from the Osage-Skiatook Petroleum Environmental Research sites, Osage County, Oklahoma doc

... respectively; the water is dominantly Na-Cl and has the other chemical characteristics of produced water. Environmental impacts of petroleum production: Fate of inorganic and organic chemicals in ... Y.K., and Godsy, E.M., " ;Environmental impacts of petroleum production: The fate of petroleum and other organics associated with produced water from the Osage- Skiatook petroleum environmental ... concentrations of selected inorganic and organic chemicals from surface and ground water samples from OSPER ‘A’ and ‘B’ sites and adjoining areas in Osage County, OK are listed in Table 2 and 3, respectively....
  • 30
  • 881
  • 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, werevealed that exon 9 played a major role in the induc-tion of mitochondria-mediated apoptosis and ... (sense) and 5Â-GAAAAAACGCGATCCTACTT-3Â (antisense). Primersfor unmethylated DNA were: 5Â-GAAGTAGGTGGAGTATTGAAT-3Â (sense) and 5Â-CAAAAAAACACAATCCTACTT-3Â (antisense).Caspase 3 activityCells subjected ... apoptosis and invasion FEBS Journal 275 (2008) 31453156 ê 2008 The Authors Journal compilation ê 2008 FEBS 3155 A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and...
  • 12
  • 613
  • 0
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

... functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 Judit Rumszauer, Cornelia Schwarzenlander and Beate ... represent-atives, such as Thermus thermophilus strain HB27, Thermus thermophilus HB8, Thermus flavus AT62, Thermus caldophilus, and Thermus aquaticus YT1, exhi-bit the extraordinary trait of high transformation ... implicated in retraction of the PilA4- comprising DNA translocator transporting the DNA through the periplasmic space. Binding of the DNA to the DNA-binding proteinComEA on the surface of the inner...
  • 12
  • 702
  • 0
Báo cáo

Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt

... out the field work in Phu An commune, located in the Tam Giang Lagoon, Central Vietnam in September, 2009. In this paper, the authors attempt to examine the changes of surface water environment ... based coastal resources management activities in the Tam Giang Lagoon, Central Vietnam. The results show that the lagoon’s surface water has been polluted. BOD5, COD and nutrient concentration ... Thus, it can be affirmed that there was present of organic substances in the water environment in the Tam Giang Lagoon and the lagoon’s water has a polluted sign. According to the authors’...
  • 11
  • 528
  • 0
studies in surface science and catalysisAAAA4cMETHODS FOR MONITORING AND DIAGNOSING THE potx

studies in surface science and catalysisAAAA4cMETHODS FOR MONITORING AND DIAGNOSING THE potx

... legislation for monitoring catalytic converters was in 1988 in the United States, with the OBD I1 (On-Board Diagnostics) standard. The definite form of this standard was issued in I99 1 by the ... between the substrate and the housing for thermal protection of the environment. In the case of ceramic monoliths, a resilient mat is also provided between the housing and the substrate in ... Methods for Monitoring and Diagnosing the Efficiency of Catalytic Converters In addition to the noble metals, the alumina washcoat of a three-way catalytic converter also contains other components...
  • 471
  • 488
  • 0
báo cáo hóa học:

báo cáo hóa học: " The role of interleukin-12 in the heavy metal-elicited immunomodulation: relevance of various evaluation methods" potx

... it is involved in the main-tenance of an ongoing Th1 response rather than part of the initial immunological decision-making process. In the current study, the finding that production of IL-12depends ... purposes)Journal of Occupational Medicine and ToxicologyOpen AccessResearch The role of interleukin-12 in the heavy metal-elicited immunomodulation: relevance of various evaluation methodsNasr YA Hemdan1,2,3Address: ... IL-12p70 and the induction of Th1 response, itseems that IL-12 may play a central role in attaining apolarized Th1/Th2 response in heavy metal-exposed indi-viduals even in the absence of pathogenic...
  • 14
  • 435
  • 0
ADVANCES IN WAVELET THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY doc

ADVANCES IN WAVELET THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY doc

... THEORY AND THEIR APPLICATIONS IN ENGINEERING, PHYSICS AND TECHNOLOGY Edited by Dumitru Baleanu Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology ... in Engineering, Physics and Technology, Edited by Dumitru Baleanu p. cm. ISBN 978-953-51-0494-0 Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology ... speed and 1MB of RAM (TI, 2006). Advances in Wavelet Theory and Their Applications in Engineering, Physics and Technology 26The fact that the DWT approximation contains the most of the information...
  • 646
  • 626
  • 0
Báo cáo y học:

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... fwd ACGTTGGATGGGGCACCAATTAACTAAGGCrev ACGTTGGATGTGAGGGCATGGAAGGTTCAGGCCGGCTCCCAAGCTCC 92.03S1 rs3918396 G /A 0.09 0.09 fwd ACGTTGGATGAGTCGGTAGCAACACCAGGCrev ACGTTGGATGAATCCCCGCAGACCATGACACCCTGCTGGCCATGCTCCTCAGC ... 12(page number not for citation purposes)Respiratory ResearchOpen AccessResearch The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function ... asthma by Lind [21] and Raby [6] could not findany association between single ADAM33 SNPs or haplo-types and childhood asthma. However, no analyses of ADAM33 effects on non atopic asthma have...
  • 12
  • 355
  • 0
Khóa luận tiếng anh PESTICIDE USE AND MANAGEMENT IN THE MEKONG DELTA AND THEIR RESIDUES IN SURFACE AND DRINKING WATER

Khóa luận tiếng anh PESTICIDE USE AND MANAGEMENT IN THE MEKONG DELTA AND THEIR RESIDUES IN SURFACE AND DRINKING WATER

... residues in drinking water sourced from surface waters are also monitored. In this chapter, drinking water sources and the situation of drinking water supply in the Delta is presented. Water using ... 105 5.1.1 An Overview of Drinking Water Resources 105 5.1.2 Dinking Water Supply in the Delta 107 5.2 Pesticide Residues in Drinking Water Source at the Suburban Areas of Can Tho ... commonly used pesticide residues in drinking water originating from surface water when treated via “traditional” treatment methods as well as exposure of human health to pesticides in drinking water. ...
  • 202
  • 470
  • 0
investigation the heavy metal contents in surface water and sediment collected in thadluang marsh

investigation the heavy metal contents in surface water and sediment collected in thadluang marsh

... OVERVIEW OF WATER AND SEDIMENT POLLUTION IN THADLUANG MARSH 1.1. Topography of Thad Luang marsh The ThadLuang Marshland is the largest remaining wetland in Vientiane Municipality, located on the ... SCIENCE PHETDALAPHONE BOUTTAVONG INVESTIGATION THE HEAVY METAL CONTENTS IN SURFACE WATER AND SEDIMENT COLLECTED IN THADLUANG MARSH (LAO PDR) MASTER THESIS Supervisor: Assoc. Prof. ... pollution in ThadLuang marsh Table 2.1: Characteristics of the sampling points in Thadluang marsh Table 2.2: Characteristics of the sediment points in Thadluang marsh Table 2.3: The optimal...
  • 69
  • 250
  • 0
Determination of Non-Steroidal Anti-Inflammatory Drugs (Nsaids) in Surface Water at Ho Chi Minh City

Determination of Non-Steroidal Anti-Inflammatory Drugs (Nsaids) in Surface Water at Ho Chi Minh City

... Journal of Natural Sciences and Technology, Vol. 30, No. 1 (2014) 7-12 7 Determination of Non-Steroidal Anti-Inflammatory Drugs (Nsaids) in Surface Water at Ho Chi Minh City Đỗ Vũ Ho ng ... aims at setting up an analytical method for determination of 4 Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) including ketoprofen, ibuprofen, diclofenac sodium and mefenamic acid in surface water. ... the selected compounds in fifteen surface water samples collected in Ho Chi Minh City. The analysis results show that their residues currently do exist in surface water in the study area. Keywords:...
  • 6
  • 344
  • 0

Xem thêm

Từ khóa: heavy metal pollution in soil pdfheavy metal analysis in soil pdfmonitoring of radionuclide and heavy metal accumulation in sediments algae and biota in black sea marine ecosystems1transport within aquatic systems the role of water and sedimentmalhem kinetics of the reactions of ethylene oxide with water and ethylene glycolbioremediation of seleniferous water and sedimentrainfall water and sedimentheavy metal contamination of municipal effluent in soil and plantsthe description of the suggested esp contents for construction at vinh university in the course 4water and electrolyte absorption in the gutcities water and climate change in 2050 an indicator approach to understanding the risk for 31 citiesthe effect of ground water withdrawals on surface watersome common types of biogeochemical reactions affecting transport of chemicals in ground d water and surface wateruse of environmental tracers to determine the interaction of ground water and surface watereffects of irrigation development on the interaction of ground water and surface waterNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ