... ex- tending above a line tangential to the supraorbital margin (horizontal line). Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line ... supercilliary arcs does not indicate the absence, presence or size of the frontal sinus [3]. The objective of this study was to investigate the prevalence of...
Ngày tải lên: 25/10/2012, 11:04
... Agency of International Business and Cooperation, 2009. [17] Ministry of Energy and Mining. Renewable Energy in Serbia. Ministry of Energy and Mining, 2009. [18] Statistical Office of the ... Republic of Serbia. Strategy of development of energy industry of Republic of Serbia until 2015, draft report, 2005. [6] EPS – Electric Power Industry of S...
Ngày tải lên: 05/09/2013, 16:10
Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx
... compilation ê 2010 FEBS Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation Valeria Alina Campos-Bermudez, ... is located in the C-terminal domain, the E. coli Pta N-terminal domain is involved in stabilization of the hexameric native structure, in expres...
Ngày tải lên: 06/03/2014, 11:20
báo cáo hóa học: " The Locomotor Capabilities Index; validity and reliability of the Swedish version in adults with lower limb amputation" ppt
... and advanced locomotor skills of the lower limb amputee with the pros- thesis and assesses level of independence" [13]. The LCI has demonstrated good validity and reliability in adults with ... successfully fitted with a prosthesis may differ in how much they use the prosthesis and in the type of activities they can perform with their pro...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Analysis of machine perfusion benefits in kidney grafts: a preclinical study" doc
... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage. Ann Transplant 2004, 9:31-32. 41. ... group. Functional parameters Animals were placed in individual metabolic cages for blood and urine collection. Functional parameters were measured using an automatic analyzer (Modular...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Analysis of machine perfusion benefits in kidney grafts: a preclinical study" pdf
... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage. Ann Transplant 2004, 9:31-32. 41. ... was invaluable. Alanine aminopeptidase and b-N-acetylglucosaminidase are found in kidney tubular cell s br ush border and their presence in urine is a com- monly accepted sign o...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: "Research Article Segmentation, Reconstruction, and Analysis of Blood Thrombus Formation in 3D 2-Photon Microscopy Images" pot
... and P. R. Bergstresser, “Mining biomedical images with density-based clustering,” in Proceedings of International Conference on Information Technology: Coding and Computing (ITCC ’05), vol. 1, ... attain different levels of details of the clot surface. The α-shape of the point cloud degenerates to the input point set as the value of α approaches to 0, and it becomes the conve...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo sinh học: "Comprehensive curation and analysis of global interaction networks in Saccharomyces cerevisiae" doc
... for interrogation of gene and protein function, including DNA microarrays for global gene-expression profiling and location of DNA-binding factors, and a comprehensive set of gene deletion strains ... number of interactions in the LC dataset (left) and standard HTP datasets (right). Protein-protein interactions, blue; gene-gene interactions, yellow. (b) The number of pub...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" ppsx
... participated in the conception and design of the project and in the analysis and interpretation of data and contributed substantially to the drafting of the manuscript. VFP partici- pated in the ... not significant in the univariate analysis and had no impact on the frequency of the metabolic syndrome. Conclusion In summary, this study suggest...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Expression and function of inducible co-stimulator in patients with systemic lupus erythematosus: possible involvement in excessive interferon-γ and anti-double-stranded DNA antibody production" pot
... http://arthritis-research.com/content/8/3/R62 Page 1 of 14 (page number not for citation purposes) Vol 8 No 3 Research article Expression and function of inducible co-stimulator in patients with systemic lupus erythematosus: possible involvement ... saline; PE = phycoerythrin; PerCP = peridinin chlorophyll protein; SD = standard deviation; SLE = systemic lupus...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo khoa học: " A dosimetric analysis of respiration-gated radiotherapy in patients with stage III lung cancer" pptx
... Fukuoka M, Kawahara M, et al.: Phase III study of con- current versus sequential thoracic radiotherapy in combina- tion with mitomycin, vindesine, and cisplatin in unresectable stage III non-small-cell ... motion and also respiration-gated PTVs in expira- tory phases. Of note is the finding that significant gains are attained simply by using individualized 4D mobility ma...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" pptx
... will have an increased prevalence of each of the individual components of the metabolic syndrome (dyslipidaemia, hypertension, hyperg- lycaemia, and central obesity) as well as the metabolic syn- drome ... It is therefore possible that, in RA patients, alterations in body fat/muscle may have already occurred as part of the dis- ease process and thus any addition...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx
... article as: Bonner et al.: ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system. Implementation Science 2010 ... 5:63 http://www.implementationscience.com/content/5/1/63 Page 8 of 8 RESEARC H ARTIC LE Open Access ’To take care of the patients’: Qua...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
... DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC. ... genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization Binod B Sahu* and Birendra P Shaw Address: Environmen...
Ngày tải lên: 12/08/2014, 03:20
finite element simulation and analysis of local stress concentration in polymers with a nonlinear viscoelastic constitutive model
Ngày tải lên: 29/11/2014, 07:00