finite element simulation and analysis of local stress concentration in polymers with a nonlinear viscoelastic constitutive model

... ex- tending above a line tangential to the supraorbital margin (horizontal line). Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line ... supercilliary arcs does not indicate the absence, presence or size of the frontal sinus [3]. The objective of this study was to investigate the prevalence of...

Ngày tải lên: 25/10/2012, 11:04

... Agency of International Business and Cooperation, 2009. [17] Ministry of Energy and Mining. Renewable Energy in Serbia. Ministry of Energy and Mining, 2009. [18] Statistical Office of the ... Republic of Serbia. Strategy of development of energy industry of Republic of Serbia until 2015, draft report, 2005. [6] EPS – Electric Power Industry of S...

Ngày tải lên: 05/09/2013, 16:10

... compilation ê 2010 FEBS Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation Valeria Alina Campos-Bermudez, ... is located in the C-terminal domain, the E. coli Pta N-terminal domain is involved in stabilization of the hexameric native structure, in expres...

Ngày tải lên: 06/03/2014, 11:20

... and advanced locomotor skills of the lower limb amputee with the pros- thesis and assesses level of independence" [13]. The LCI has demonstrated good validity and reliability in adults with ... successfully fitted with a prosthesis may differ in how much they use the prosthesis and in the type of activities they can perform with their pro...

Ngày tải lên: 18/06/2014, 18:20

... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage. Ann Transplant 2004, 9:31-32. 41. ... group. Functional parameters Animals were placed in individual metabolic cages for blood and urine collection. Functional parameters were measured using an automatic analyzer (Modular...

Ngày tải lên: 18/06/2014, 19:20

... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D: Weight increase during machine perfusion may be an indicator of organ and in particular, vascular damage. Ann Transplant 2004, 9:31-32. 41. ... was invaluable. Alanine aminopeptidase and b-N-acetylglucosaminidase are found in kidney tubular cell s br ush border and their presence in urine is a com- monly accepted sign o...

Ngày tải lên: 20/06/2014, 03:20

... and P. R. Bergstresser, “Mining biomedical images with density-based clustering,” in Proceedings of International Conference on Information Technology: Coding and Computing (ITCC ’05), vol. 1, ... attain different levels of details of the clot surface. The α-shape of the point cloud degenerates to the input point set as the value of α approaches to 0, and it becomes the conve...

Ngày tải lên: 21/06/2014, 19:20

... for interrogation of gene and protein function, including DNA microarrays for global gene-expression profiling and location of DNA-binding factors, and a comprehensive set of gene deletion strains ... number of interactions in the LC dataset (left) and standard HTP datasets (right). Protein-protein interactions, blue; gene-gene interactions, yellow. (b) The number of pub...

Ngày tải lên: 06/08/2014, 18:21

... participated in the conception and design of the project and in the analysis and interpretation of data and contributed substantially to the drafting of the manuscript. VFP partici- pated in the ... not significant in the univariate analysis and had no impact on the frequency of the metabolic syndrome. Conclusion In summary, this study suggest...

Ngày tải lên: 09/08/2014, 01:22

... http://arthritis-research.com/content/8/3/R62 Page 1 of 14 (page number not for citation purposes) Vol 8 No 3 Research article Expression and function of inducible co-stimulator in patients with systemic lupus erythematosus: possible involvement ... saline; PE = phycoerythrin; PerCP = peridinin chlorophyll protein; SD = standard deviation; SLE = systemic lupus...

Ngày tải lên: 09/08/2014, 07:20

... Fukuoka M, Kawahara M, et al.: Phase III study of con- current versus sequential thoracic radiotherapy in combina- tion with mitomycin, vindesine, and cisplatin in unresectable stage III non-small-cell ... motion and also respiration-gated PTVs in expira- tory phases. Of note is the finding that significant gains are attained simply by using individualized 4D mobility ma...

Ngày tải lên: 09/08/2014, 10:20

... will have an increased prevalence of each of the individual components of the metabolic syndrome (dyslipidaemia, hypertension, hyperg- lycaemia, and central obesity) as well as the metabolic syn- drome ... It is therefore possible that, in RA patients, alterations in body fat/muscle may have already occurred as part of the dis- ease process and thus any addition...

Ngày tải lên: 09/08/2014, 13:22

... article as: Bonner et al.: ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system. Implementation Science 2010 ... 5:63 http://www.implementationscience.com/content/5/1/63 Page 8 of 8 RESEARC H ARTIC LE Open Access ’To take care of the patients’: Qua...

Ngày tải lên: 10/08/2014, 10:23

... DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC. ... genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization Binod B Sahu* and Birendra P Shaw Address: Environmen...

Ngày tải lên: 12/08/2014, 03:20

Ngày tải lên: 29/11/2014, 07:00