... for data interpretation As the research’s aim is to examine the impact of Peer- teaching on ESP teaching and learning quality, the collected data of the study was analyzed both quantitatively ... about peer teaching. Due to the limitation of the study, the investigator has only made a survey on the current practice of peer teaching in ESP...
Ngày tải lên: 29/01/2014, 10:49
... occur in the context of a DNase I sensitive chromatin region, or a region with active- type histone modifications. Transgenic mice with a 99 bp deletion (containing two Pit-1 binding sites) of the ... expression level of Ig-b mRNA. Presence of DHSs in the Ig-b locus in cells deleted in regions I IV DHSs in the Ig-b locus were examined by genomic S...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu CASH MANAGEMENT TECHNIQUES: THE CASE OF CASH FORECASTING IN MERCATOR pdf
... 3.7.3 Cash flow forecasting process 52 3.7.4 Cash flow forecasting techniques 56 4 CASH FLOW FORECASTING IN MERCATOR D.D. 72 4.1 Company profile 72 4.2 Cash flow forecasting: the case of Mercator ... source of financing, as the company is using its own short term assets to obtain financing instead of pledging some other collateral (Zekkar, 2009). Inv...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3Â); GLU T46 2A forward (5Â- GAACAACTT AACAGATATGCCGGTTATT CCACCGGT GCC-3Â), GLU T46 2A reverse (5Â- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3Â); GLU H44 7A, ... Authors Journal compilation ê 2006 FEBS 2171 Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding s...
Ngày tải lên: 07/03/2014, 12:20
The role of international agreements in environmental conservation and its implication to Vietnam
... further examined with the relevant economic theories which are introduced in the Chapter 2 of the thesis. By applying economic theories, the roles and mechanisms of international agreements in ... for the depleting precious environmental natural resources such as tropical forests. The purpose of the thesis is to examine how International Agreements env...
Ngày tải lên: 20/04/2014, 20:22
Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf
... repair the link break, the node broadcasts an RREQ for that destination. Otherwise, the node makes a list of unreachable destinations consisting of the unreachable neighbor and any additional ... Resta, and P. Santi, A statistical analysis of the long-run node spatial distribution in mobile ad hoc networks,” in Proceedings of the ACM International Workshop...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo lâm nghiệp: "Study of the properties of thirteen tropical wood species to improve the prediction of cutting forces in mode B" pptx
... to estimate cutting forces during wood machining, a factor remains difficult to take into consideration: the influence of wood species. Therefore, the aim of this study is to understand the influence ... estimating cutting forces involved during machining, particularly with difficulties in taking the influence of wood species into account accurately (wit...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
... 7:25 http://www.virologyj.com/content/7/1/25 Page 4 of 7 RESEARC H Open Access Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes Huimin ... 129:283-290. doi:10.1186/1743-422X-7-25 Cite this article as: Xu et al.: Genomic variability in Potato virus M...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot
... article as: Wolfe and Michaud: The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study. Arthritis Research & Therapy 2010 12:R35. Wolfe ... 0.749) Effect of biologic therapy on annual rates of progression of disability, loss of health status, and costs in patients pr...
Ngày tải lên: 12/08/2014, 11:23
Báo cáo y học: " Exploring the optimum approach to the use of CT densitometry in a randomised placebo-controlled study of augmentation therapy in alpha 1-antitrypsin deficiency" pptx
... CT scan as Lung Endpoints (EXACTLE) trial aimed to clarify the optimum approach to the use of CT densitometry data for the assessment of alpha 1-antitrypsin (AAT) augmentation therapy on the progression ... contributed to the design of the study, in the analysis and interpretation of data, and drafting of the manuscript. AD was responsibl...
Ngày tải lên: 12/08/2014, 14:20
Determinants of customer loyalty in mobile telecommunication sector A case of VinaphoneDeterminants of customer loyalty in mobile telecommunication sector A case of Vinaphone
... customer satisfaction and customer loyalty toward each mobile operators in Vietnam, especially Vinaphone To find out the determinants of customer loyalty and to verify the model of Vietnam mobile ... nationwide with more than 200 transaction office. These transaction points are also the supporting point of Vinaphone. Besides the official transaction office, V...
Ngày tải lên: 25/11/2014, 00:33
Antecedents of brand loyality in Vietnam banking sector.The case of Vietnam credit card users
... Title: ANTECEDENTS OF BRAND LOYALTY IN VIETNAM BANKING SECTOR: CASE OF VIETNAM CREDIT CARD USER Comments: Credit card in Vietnam has been developing rapidly in terms of the number of card ... CHAPTER 1: INTRODUCTION 1.1 Background Credit card in Vietnam has been developing rapidly in terms of the number of card and transaction value...
Ngày tải lên: 25/11/2014, 00:36
The role of international agreements in environmental conservation and its implication to Vietnam
... VIETNAM NATIONAL UNIVERSITY FACULITY OF ECONOMIC YASUKATA FUKAHORI THE ROLE OF INTERNATIONAL AGREEMENTS IN ENVIRONMENTAL CONSERVATION AND ITS IMPLICATION TO VIETNAM Major: ... FUKAHORI THE ROLE OF INTERNATIONAL AGREEMENTS IN ENVIRONMENTAL CONSERVATION AND ITS IMPLICATION TO VIETNAM Major: Political Economy Code: 62.3...
Ngày tải lên: 17/03/2015, 13:26
Application of strategic management in marketing strategic formulation the case of UDIC
... IMPLICATION FOR MARKETING 12 1.3.2 STRATEGIC MARKETING PLANNING MODEL 13 1.4 BEST PRACTICES OF STRATEGIC MARKETING PLANNING 23 CHAPTER 2 28 STATUS OF UDIC S STRATEGIC MARKETING PLANNING FOR THE REAL ... school of business Chu Thi Phuong Thao Application of strategic management in Marketing strategy formulation the CASE OF...
Ngày tải lên: 26/03/2015, 08:52
Determinants of customer satisfaction in retail banking sector Luận văn thạc sĩ
... provides its customers. 2.4 Customer satisfaction and service quality in banking sector 2.4.1 Customer satisfaction in banking sector Customer satisfaction is an outstanding research topic of different ... quality 14 2.4 Customer satisfaction and service quality in banking sector 16 2.4.1 Customer satisfaction in banking sector 16 2.4.2 Ser...
Ngày tải lên: 18/05/2015, 03:42