structure and written expression toefl exercises

... can be any order in the sentence. However, it usually follows V and comes before ADJ or other V s . STRUCTURE AND WRITTEN EXPRESSION PART A: SENTENCE COMPLETION There are fifteen questions ... singular in meaning and take a singular verb. ã Tittle of books and movies, even if plural in form, take singular verbs. B. Plural subjects ã Subjects joined by and or both and take...

Ngày tải lên: 13/12/2013, 03:15

... parallel structure with coordinate conjunctions (same structure) + (and, but, or) +(same structure) (same structure) , (same structure) , (and, but, or), (same structure) Skill 25: Use Parallel structure ... the first or last line of the passage. STRUCTURE AND WRITTEN EXPRESSION I. STRUCTURES A. Sentences with one clause Skill 1: be sure a sentence have S and V Skill 2:...

Ngày tải lên: 13/12/2013, 03:15

... eliminate that choice and increase your chance of answering correctly. TOEFL STUDY GUIDE PART 3 STRUCTURE AND WRITTEN EXPRESSION Structure & Written Expression Structure questions: ... choices fits correctly into the particular sentence. Written Expression questions: test the ability to recognize correct grammar and to detect errors in stand...

Ngày tải lên: 24/12/2013, 19:15

... sentence. Is it a physical action, a mental action, or a state of being? TOEFL STUDY GUIDE PART 3 STRUCTURE AND WRITTEN EXPRESSION Sentence Completion Tips 49 - 50 Sentence Completion Tip ... were", "there was", "it is", and "it was" are examples of no main verb or subject and are classed as expressions. Sentence Completion...

Ngày tải lên: 24/12/2013, 19:15

... different meanings. Structure: Error Identification TIP 56 TOEFL STUDY GUIDE PART 3 STRUCTURE AND WRITTEN EXPRESSION Error Identification Tips 51 – 59 (cont) Structure: Error Identification ... job." Structure: Error Identification TIP 59 Remember the parts of the sentence that are NOT underlined are correct as written. You can look at these parts that...

Ngày tải lên: 24/12/2013, 19:15

... planks and chopsticks in Japan. (D) 28. Compared with another spiders, tarantulas actually have very little poison, and some have no (A) (B) (C) poison at all. (D) 29. Fruit and vegetable ... 16. The Pulitzer Prize has became the most cherished and sought after annual award for quality (A) (B) works in the field of journalism and literature. (C) (D) 17. Doct...

Ngày tải lên: 26/12/2013, 00:17

... BABBC BABCC ABCDC For more material and information, please visit Tai Lieu Du Hoc at www.tailieuduhoc.org Structure and Written Expression 1. Spain and Portugal’s competition for economic ... education. 38. The human brain expanded at first at a rate of one cubic inch every one hundred thousand of years, and then began to double. For more material and info...

Ngày tải lên: 26/12/2013, 00:17

... spite of (C) nor For more material and information, please visit Tai Lieu Du Hoc at www.tailieuduhoc.org SECTION TWO: Structure and Written Expression (3) 1. Henry David Thoreau’s Walden ... Sunlight during dawn or dusk comes in at a lower angle, and since it cannot escape the dust and pollution of the atmosphere , the sky turns orange and then red. (A) as...

Ngày tải lên: 23/01/2014, 06:20

... the news. C D For more material and information, please visit Tai Lieu Du Hoc at www.tailieuduhoc.org SECTION TWO: Structure and Written Expression (4) 1. The giraffe uses its ... Winston-Salem. (A) The Kootenay Band Tribe becoming (B) While The Kootenay Band Tribe becomes (C) Because The Kootenay Band Tribe became (D) The Kootenay Band Tribe has become 8....

Ngày tải lên: 23/01/2014, 06:20

... stained SDS ⁄ PAGE containing natural Lol p 1 (nLol p 1) , natural Phl p 1 (nPhl p 1) , eukaryotic recombinant Phl p 1 (ErPhl p 1) and bacterial recombinant Phl p 1 (PrPhl p 1) . B and C represent immunoblots ... 1 (ErPhl p 1+ ). PrPhl p 1- and ErPhl p 1- show the IgE binding without preadsorption of sera. (B) Inhibition of IgE bi...

Ngày tải lên: 16/03/2014, 18:20

... organization of the ORF region of the RNase j family genes is shown in Fig. 7A. In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... (2008) 62176227 ê 2008 The Authors Journal compilation ê 2008 FEBS Genomic structure and expression analysis of the RNase j family o...

Ngày tải lên: 23/03/2014, 06:20

... gene and 3Â end of a signal peptide: 5Â-CAGAAGCGGAA GAAA GCATGCAAAGGCAGA-3Â (number 2), were used. In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene. Two others: forward 5Â-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3Â and reverse 5Â-AATTCTCATTA CTACCTCTGCG...

Ngày tải lên: 30/03/2014, 13:20

... 3725 Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) Susan E. Douglas, Aleksander ... degeneration of the sequences upstream of the pseudogenes made it impossible to predict the locations of the first introns and exons of...

Ngày tải lên: 31/03/2014, 07:20

... orders@intechweb.org Viral Genomes – Molecular Structure, Diversity, Gene Expression Mechanisms and Host-Virus Interactions, Edited by Maria Laura Garcia and Víctor Romanowski p. cm. ISBN ... ciltivars and breeding lines. J.Amer. Soc. Hort. Sci. 120:741-746. Viral Genomes – Molecular Structure, Diversity, Gene Expression Mec...

Ngày tải lên: 31/03/2014, 19:20

... 月语法语 1. The difference between libel and slander is that libel is printed while__________. (A) spoken is slander (B) is spoken slander (C) slander is spoken (D) is slander spoken 2. Great numbers of ... number of books and plays have also been written by Sonia Sanchez (B) Sonia Sanchez has also written a number of books and plays (C) A number of Sonia Sanchez books and plays h...

Ngày tải lên: 16/11/2014, 11:58