the regulation of genes involved in trichome development(fileminimizer)
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... Ivyspring International Publisher. All rights reserved Research Paper Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes ... expression and activation of cytokines and chemokines in monocytes and macrophages (including Kupffer cells) [41, 42], and ethanol- induced mucosa...
Ngày tải lên: 31/10/2012, 15:28
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... suggest that certain enzymes, and therefore the corresponding genes of the A2 0 1A biosyn- thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways, respectively. The ... Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A2 0 1A from...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... devoid of a given essential amino acid. Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dep...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Calcium-induced contraction of sarcomeres changes the regulation of mitochondrial respiration in permeabilized cardiac cells doc
... arrange- ment of mitochondria in the cells, in the changes in the kinetics of regulation of mitochondrial respiration by exogenous ADP and ATP, and in the direct channelling of endogenous ADP and ATP ... disorganization of the regular intracellular mitochondrial arrangement, calcium induced changes in the kinetics of regulation of the resp...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx
... the ratioofglycogenC6andC1(Glyc 6 /Glyc 1 ), we conclude thattherelativeisotopicenrichmentinC6ofGlc6P was significantly higher in ADM than that in control mice. Therateof 13 C label incorporation into ... glycogen C6 even in the presence of decreased activity of the indirect pathway, provided that the increase in glycolytic flux exceeded the decreased gluconeogenic...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Identification of domains involved in the allosteric regulation of cytosolic Arabidopsis thaliana NADP-malic enzymes ppt
... (2009) 56655677 ê 2009 The Authors Journal compilation ê 2009 FEBS Identification of domains involved in the allosteric regulation of cytosolic Arabidopsis thaliana NADP-malic enzymes Mariel C. Gerrard ... that in this chimera a change in the pKa value of the amino acid residue(s) involved in malate inhibition may occur as a result of interaction...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... NM_007601 .3 mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC CARP Ankyrin repeat domain 1 NM_0 134 68 mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R ... 31 9 CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC pDNter2 CARP from 71 to 31 9 CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC pDNter3 CARP from 102 to...
Ngày tải lên: 29/03/2014, 21:20
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf
... transmigration of monocytes and macrophages across the BBB to the sites of axonal injury in the brain [33,37]. Both in vitro and in vivo findings suggest that hypoxia/ischemia-induced infiltra- tion of monocytes ... HIF-1-binding sites in the pro- moter regions of MCP-1 and MCP-5 genes. Hypoxia and CoCl 2 up-regulate the expression of both HIF-1α and...
Ngày tải lên: 19/06/2014, 22:20
báo cáo khoa học: "Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach" pdf
... RESEARC H ARTIC L E Open Access Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics approach Marcel C van Verk, John F Bol and Huub JM Linthorst * Abstract Background: ... this article as: van Verk et al.: Prospecting for Genes involved in transcriptional regulation of plant defenses, a bioinformatics app...
Ngày tải lên: 11/08/2014, 11:20
báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt
... Open Access The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress Massimo ... this article as: Galbiati et al.: The grapevine guard cell-related VvMYB60 transcription factor is involved in the...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Characterization of Vitis vinifera NPR1 homologs involved in the regulation of Pathogenesis-Related gene expression" ppsx
... proteins sharing two domains involved in mediating protein-protein interactions: the Broad Complex, Tramtrack and Bric a brac/Pox virus and Zinc finger (BTB/POZ) domain in the N-terminal and the ... basic chitinases (PR3) in the absence of pathogen infection. Interestingly, when VvNPR1.1 or AtNPR1 were transiently overexpressed in Vitis vinifera leaves, the induction...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot
... GT- 3' (f), 5'-CTG GAA CAC GTT TCT GAA AGA AT-3' (r); beta-actin, 5'-ACC CTA AGG CCA ACC GTG A- 3' (f), 5'- CAG AGG CATA CAG GGA CAG CA-3' (r); GapDH, 5'- TGG ... Central Page 1 of 16 (page number not for citation purposes) Respiratory Research Open Access Research Transcriptome profiling of primary murine monocytes, lung macrophages...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Alveolar macrophage-epithelial cell interaction following exposure to atmospheric particles induces the release of mediators involved in monocyte mobilization and recruitment" pot
... Access Research Alveolar macrophage-epithelial cell interaction following exposure to atmospheric particles induces the release of mediators involved in monocyte mobilization and recruitment Hiroshi ... epithelial cells (HBEC) enhances the synthesis and release of a variety of pro- inflammatory cytokines and that supernatants from these co-cul...
Ngày tải lên: 12/08/2014, 18:22
the regulation of genes involved in trichome development
... Plants 46 CHAPTER 3. THE ROLE OF GLABRA3 IN TRICHOME DEVELOPMENT AND THE RELATION OF GLABRA3 FUNCTION TO THE EXPRESSION OF GENES INVOLVED IN TRICHOME DEVELOPMENT 47 3.1 Introduction 47 3.2 ... finding the components of the initiation and inhibitory elements, but also in uncovering how these elements interact. Based upon data found in Arabidopsis...
Ngày tải lên: 14/11/2014, 11:55
the regulation of genes involved in trichome development(fileminimizer)
... finding the components of the initiation and inhibitory elements, but also in uncovering how these elements interact. Based upon data found in Arabidopsis and other species, a model of the interaction ... the role of GL3 in trichome initiation and uses plants expressing varying levels of GL3 to determine if genes involved in trichome development are regulat...
Ngày tải lên: 14/11/2014, 12:16