active learning for sequential screening and classification of molecular and genomic data

... Satisfactory results have not yet been obtained in therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome (APS). We therefore compared single antiplatelet therapy ... therapy and a combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with AP...

Ngày tải lên: 26/10/2012, 09:48

... supplement to IEC 6007 9-4 (1966), Electrical apparatus for explosive gas atmospheres – Part 4: Method of test for ignition temperature IEC 6007 9-2 0:1996, Electrical apparatus for explosive gas atmospheres ... 426: Electrical apparatus for explosive atmospheres IEC 6007 9-4 :1975, Electrical apparatus for explosive gas atmospheres...

Ngày tải lên: 25/12/2013, 10:41

... well-aware of themselves and their learning, they were more analytical about the processes involved in learning. They used a number of different metacognitve strategies in all three categories of ... the effect of learners beliefs about language learning on their choice of strategies. They find out that learners who emphasize the importance of lea...

Ngày tải lên: 29/01/2014, 00:23

... because of fever. Disseminated tuberculosis . Disseminated tuberculosis oc- curs because of the inadequacy of host defenses in containing tuberculous infection. This failure of containment ... HIV VII. Classification of Persons Exposed to and/ or Infected with Mycobacterium tuberculosis VIII. Reporting of Tuberculosis References INTRODUCTION The Diagnostic...

Ngày tải lên: 15/02/2014, 12:20

... activity in crude yeast extract as the untagged protein, indicating that the tag was not interfering with the protein activity. The tagged protein was purified and then used for further analysis. In the ... nkatặmg )1 . The GLD1 pro- tein was tagged with a histidine tag at the N-terminal end by adding the coding sequence for six histidines to the end of the open...

Ngày tải lên: 19/02/2014, 06:20

... catering (including vending machines) and the food and drink children bring into school, the taught curriculum (including PE), school travel plans and provision for cycling, and policies relating ... Section 3 on pages 59 and 60 has links to tools to help with implementing the recommendations, meeting training needs, evaluating the impact of action and working...

Ngày tải lên: 21/02/2014, 11:20

... evidence of effectiveness, including cost effectiveness. They include recommendations on the clinical management of overweight and obesity in the NHS, and advice on the prevention of overweight and ... overweight and obesity in adults and children in England and Wales. The guidance aims to: ã stem the rising prevalence of obesity...

Ngày tải lên: 22/03/2014, 09:20

... Union and adopt a common classification of goods and services for the purposes of the registration of marks (hereinafter designated as the Classification ). (2) The Classification consists of: (i) ... the International Classification of Goods and Services for the Purposes of the Registration of Marks. If the applicant does not...

Ngày tải lên: 30/03/2014, 06:20

... Recordal of Change in the Ownership of an International Registration At the request of the person in whose name the international registration stands, or at the request of an interested Office ... some of the Contracting Parties in whose territories the said registration has effect and in respect of all or some of the goods and services list...

Ngày tải lên: 30/03/2014, 06:20

... for Computational Linguistics Assessing the Costs of Sampling Methods in Active Learning for Annotation Robbie Haertel, Eric Ringger, Kevin Seppi, James Carroll, Peter McClanahan Department of ... case for measuring cost in assessing AL methods. 1 Introduction Obtaining human annotations for linguistic data is labor intensive and typically the costliest part o...

Ngày tải lên: 31/03/2014, 00:20

... 8:96 http://www.hqlo.com/content/8/1/96 Page 5 of 10 RESEARC H Open Access Uncontrolled asthma: assessing quality of life and productivity of children and their caregivers using a cross-sectional Internet-based survey Bonnie B Dean 1* , ... 8:96 http://www.hqlo.com/content/8/1/96 Page 9 of 10 asthma, the mean response of caregivers of children w...

Ngày tải lên: 20/06/2014, 16:20

... (2004), / 5 (1), 59–62 Effect of ultraviolet radiation on the hatchability and survival of eggs and larvae of sheep nematode Ademola Isaiah Oluwafemi* and Ademola Janet Ayobami 1 Department of Veterinary ... of change in UV radiation intensities base on length of exposure on the hatching of nematode eggs as well as the survival rate of...

Ngày tải lên: 07/08/2014, 17:22

... et al.: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic ... tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgt...

Ngày tải lên: 10/08/2014, 10:21

... 52:48 http://www.actavetscand.com/content/52/1/48 Page 9 of 10 RESEARC H Open Access Pyelonephritis in slaughter pigs and sows: Morphological characterization and aspects of pathogenesis and aetiology Louise K Isling 1* , ... purpose of the present study was to describe the morphology, investigate the pathogenesis, and evaluate the aetiological role of E. c...

Ngày tải lên: 12/08/2014, 18:22

Ngày tải lên: 14/11/2014, 08:19