geochemical characterization of organic matter in victoria harbour sediments, hong kong

... Biodegradability of zinc binding sites in DOM of WWTP effluent in river water Fig. 3 shows the variation of DOC, UV 254 and SUVA during the incubation of DOM in WWTP effluent with river water, where river ... river water and river water spiked with DOM from WWTP effluent to evaluate the biological alteration of zinc complexation characteris...

Ngày tải lên: 05/09/2013, 10:15

... accumulation of COD Mn in Lake Biwa is the deterioration of bioactivity for DOM degradation. Accordingly, the influence of phosphorus concentration on the biodegradation of DOM was discussed in this ... naoyuki@rins.ryukoku.ac.jp Received November 19, 2010, Accepted April 1, 2011. - 215 - Influence of Phosphorus Concentration on the Biodegradat...

Ngày tải lên: 05/09/2013, 10:17

... Assessment, and Management of Organic Pollutants in Beneficially Used Residual Products Gregory B. Kester,* Robert B. Brobst, Andrew Carpenter, Rufus L. Chaney, Alan B. Rubin, Rosalind A. Schoof, and ... challenge occurring organic and inorganic compounds, but of evaluating potential effects associated with an activity also containing trace levels of synthetic...

Ngày tải lên: 14/02/2014, 03:20

... marked increases in the future demand of all organic products. This augurs well for the growth of the organic industry in the Eastern Cape and in South Africa in general. The findings of this study ... 60% of the consumers in the Transkei, 70.8% of the consumers in the Ciskei, 80% of rural consumers, 62.5% of peri-urban consumers a...

Ngày tải lên: 14/02/2014, 03:20

... substrate binding sites. In the case of the titin and twitchin kinases, the autoinhibitory sequence acts as a pseudo- substrate, occluding ATP binding and preventing protein substrates from binding ... CaM. However in PhK5 Trp357 is found at the C-terminal end of the peptide. This suggests that either PhK5 might bind with Trp357 in the N-terminal site in CaM, or...

Ngày tải lên: 19/02/2014, 17:20

... topic of uptake of organic contaminants from soil by plants. The goal was to gain insight into both experimental data and predictive methods. Knowledge of uptake of con- taminants in plants ... Uptake of organic chemicals in plants Paper II aims at determining the potential for accumulation of organic chemicals from soil in food crops. Many studies ha...

Ngày tải lên: 05/03/2014, 20:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b. ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A. thali- ana are already available [26]. We were able to obtain one T-DNA insertion line each for...

Ngày tải lên: 07/03/2014, 21:20

... Rwww ()1 CHAPTER 7 – REMEDIATION OF ORGANIC CHEMICALS IN THE VADOSE ZONE 981 ∆T The positions of the well screens and heaters are determined by the distribution and type of contaminant. The spacing of the wells ... from the demonstrations, ISTD was issued an interim or “draft” permit by the CHAPTER 7 – REMEDIATION OF ORGANIC CHEMICALS IN THE V...

Ngày tải lên: 14/03/2014, 19:20

... marketing of organic products and measures for creating of efficient supply chain of organic products in Bulgaria. Interesting conclusion can be drawn for the general food supply chain from ... 4.Improving the supply chain for organic products in Bulgaria In the survey several questions were asked concerning opinions of the experts for improving the...

Ngày tải lên: 14/03/2014, 20:20

... the uptake and degradation of organic matter by microorganisms, then DOM should play a key role in the stabilisation and destabilisation of soil organic matter, and thus, in C dynamics and C pools of soils. ... reserved. Keywords: Bioavailability; Biodegradation; Dissolved organic matter; DOC 1. Introduction In the past 10 years, much progress has been made...

Ngày tải lên: 15/03/2014, 23:22

... 587–593 www.elsevier.com/locate/jcis Effect of chlorine on adsorption/ ultrafiltration treatment for removing natural organic matter in drinking water Tae-Wook Ha, a Kwang-Ho Choo, b,∗ and Sang-June Choi b a Department of Environmental ... particulate matter did an increase in it. During the chlorination reactions, part of the particu- late matter was converted...

Ngày tải lên: 16/03/2014, 00:07

... FEBS proteins were detected in the HD -caveolae and LD -caveolae, particularly in the LD -caveolae, but there was no labelling coinciding with the VHD -caveolae (Fig. 2D). As the sulfo-NHS-biotin reagent ... (Fig. 2G), but increased in response to insulin in both the LD -caveolae and HD -caveolae, with the increase being particularly pronounced in the LD -ca...

Ngày tải lên: 16/03/2014, 13:20

... as internal standards, are rapidly oxidized and/ or chlorinated in water containing residual chlorine. Therefore, residual chlorine must be reduced at the time of sampling. These same types of compounds, ... GOOD RECOVERY. 11.2.1.3 Rinse the disk with 5 mL reagent water by adding the water to the disk and drawing most through, again leaving a layer on the surface of the di...

Ngày tải lên: 22/03/2014, 14:20

... Original article Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques Pilar Pérez-Batallón, Guzmán Ouro, Felipe Macías and ... nutrient supply rates are maintained. The main objective of this research was to examine the effect of harvesting and slash management on mineralization of...

Ngày tải lên: 08/08/2014, 14:21

... 1984). Hong Kong Island Hong Kong Island Hong Kong Island Kowloon Bay Kowloon Bay Kowloon Bay Kowloon Kowloon Victoria Harbour Victoria Harbour Victoria Harbour Victoria Harbour Hong Kong Island 1949 ... been disposed into the Harbour. Release of methane from harbour sediments during dredging activities instigated interest in studying the sources...

Ngày tải lên: 14/11/2014, 07:29