synthesis and evaluation of 2,3-dihydroquinazolinones as dual inhibitors of angiogenesis and cancer cell proliferation

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department of Biology and Biochemistry, University of Bath, UK 2 Department of ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and...
Ngày tải lên : 14/02/2014, 22:20
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

... 3525– 3601. Ó FEBS 2004 HIV-1 Protease Inhibitors (Eur. J. Biochem. 271) 4461 Role of hydroxyl group and R / S configuration of isostere in binding properties of HIV-1 protease inhibitors Hana Petrokova ´ 1 , ... on conformation of inhibitor main chain. Thus, different inhibitors differ not only in t he binding affinity, bu t a lso in the degree o...
Ngày tải lên : 19/02/2014, 16:20
  • 11
  • 615
  • 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

... Velasquez LA, Maisey K, Fernandez R, Valdes D, Cardenas H, Imarai M, Delgado J, Aguilera J, Croxatto HB: PAF receptor and PAF acetylhydrolase expression in the endosalpinx of the human Fallopian ... oviduct: a regulator of local contraction and gamete transport. J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51. 111. Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nis...
Ngày tải lên : 05/03/2014, 17:20
  • 17
  • 733
  • 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

... the SF1 DNA NTPase/helicases from Escherichia coli and Bacillus stearothermophilus, and of the SF2 HCV RNA NTPase/helicase, have confirmed the functions of these conserved motifs [13–16]. Blockage ... from the amino terminus, was amplified by PCR using the following primers: forward, 5Â-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3Â; reverse, 5Â-CTGGGATCCGTCCGAATCAGGTTCCTTC-3Â (purcha...
Ngày tải lên : 08/03/2014, 02:20
  • 9
  • 659
  • 0
Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt

Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt

... repression of the E2-containing promoters EIIaE, Ó FEBS 2003 Rb and Sp1 regulation by CDK inhibitors (Eur. J. Biochem. 270) 4821 The expression of retinoblastoma and Sp1 is increased by low concentrations ... that the inhibition of CDK activity increases the expression of Rb and Sp1. Fig. 1. Effects of UCN-01 on the levels of Rb and Sp1...
Ngày tải lên : 16/03/2014, 23:20
  • 14
  • 486
  • 0
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

... selectively hydrolyzes the RNA strand of the RNA :DNA hybrid formed during synthesis of the minus (–) strand DNA that uses (+)-strand RNA as template [2,3]. HIV-1 RNase H, similar to all the RNase Hs and together ... sixfold increase in the inhibition potency of the RNase H function, although it retained its inhibition potency on the polymerase functi...
Ngày tải lên : 22/03/2014, 16:20
  • 14
  • 425
  • 0
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc

... a molecular mass of 125 000 Da was estimated for the liver enzyme and the serum enzyme and a molecular mass of 116 000 Da for the brain enzyme, indicating that all these enzymes exist as homodimers, ... that the TRH-degrading enzyme (TRH-DE) is absent in the p lasma of neonatal rats, whereas TRH is rapidly inactivated by plasma of adult rats [39]. The...
Ngày tải lên : 31/03/2014, 21:21
  • 9
  • 477
  • 0
Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx

Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx

... 2261 Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid- hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity Kiyoshi Yamauchi and Jun–ichiro ... concentration, would poorly modulate the enzyme activity of xCTBP/xALDH1. Keywords: cytosolic thyroid- hormone-binding protein; aldehyde...
Ngày tải lên : 31/03/2014, 21:21
  • 8
  • 405
  • 0
Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx

Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx

... 2005, and October until November 2005. Measures The Inventory for Assessing the Quality of Life (ILC) This measure was developed in Germany by Mattejat and colleagues as a short and practical assessment ... 14:1573-1584. 7. Chen X, Sekine M, Hamanishi S, Wang H, Gaina A, Yamagami T, Kag- amomori S: Lifestyle and health-related quality of life in Japa- nese school...
Ngày tải lên : 18/06/2014, 22:20
  • 11
  • 567
  • 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

... 9:127 http://www.translational-medicine.com/content/9/1/127 Page 3 of 15 RESEARCH Open Access The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease Hayk Davtyan 1,2 , Anahit Ghochikyan 1 , ... Richard Cadagan 3 , Dmitriy Zamarin 3 , Irina Petrushina 2 , Nina Movsesyan 2 , Luis Martinez-Sobrido 4...
Ngày tải lên : 18/06/2014, 22:20
  • 15
  • 431
  • 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

... may indicate patients in metastasis stage. Analysis of results demonstrated that in part of the studied blood samples of cancer patients activity of CGB and GNRH1 wasonthesamelevelasincontrolgroup. There ... method of tumor cells metastatic spread detection in patients with gynecological malignances. Journal of Translational Medicine 2011 9:130. A...
Ngày tải lên : 18/06/2014, 22:20
  • 9
  • 460
  • 0
Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx

Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx

... of pcDNA3.1(+)-FLAG- tagged expression vector [43]. Primers for NS3/4A; 5'- AAGGGGGGATCCACCATG GCGCCCATCACGGCG- TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', ... 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAA...
Ngày tải lên : 20/06/2014, 01:20
  • 13
  • 475
  • 1
Báo cáo lâm nghiệp: "Environmental control of CO assimilation rate and leaf 2 conductance in two species of the tropical rain forest of French Guiana (Jacaranda copaia D. Don and Eperua falcata Aubl.)" pdf

Báo cáo lâm nghiệp: "Environmental control of CO assimilation rate and leaf 2 conductance in two species of the tropical rain forest of French Guiana (Jacaranda copaia D. Don and Eperua falcata Aubl.)" pdf

... & Cowan I.R., eds.), Stanford University Press, Stanford, pp. 323 -351 Environmental control of CO 2 assimilation rate and leaf conductance in two species of the tropical rain ... of the tropical rain forest of French Guiana (Jacaranda copaia D. Don and Eperua falcata Aubl.) R. Huc 1 J.M. Guehl 2 1 Station de...
Ngày tải lên : 09/08/2014, 04:20
  • 5
  • 324
  • 0
synthesis and evaluation of 2,3-dihydroquinazolinones as dual inhibitors of angiogenesis and cancer cell proliferation

synthesis and evaluation of 2,3-dihydroquinazolinones as dual inhibitors of angiogenesis and cancer cell proliferation

... of 60, 84, and 87 97 X List of Schemes 2.1A: Synthesis of A-Ring Analogs 1 - 14 39 2.1B: Synthesis of A-Ring Analogs 15 - 17 40 2.2A: Synthesis of Thioamide 18 41 2.2B: Synthesis of ... the vascularization of a cancerous mass usually leads to aggressive tumor growth and metastasis. This link between angiogenesis and tumor growth is so strong that the...
Ngày tải lên : 13/11/2014, 11:20
  • 226
  • 195
  • 0