synthesis and characterization of novel polymers for functional and stimuli responsive silicon surfaces

... using primers (5Â-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3Â), and checked for the presence and ... (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG CCTGCAGGTCGACTCTAGAGGATCT...

Ngày tải lên: 07/03/2014, 16:20

... Glycobiology 2, 2540. 2646 A. Ylo ă nen et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod Anne Yloă nen 1 , Jari Helin 1 , ... sequencing of the kininogens was only success- ful from the 42-kDa band of wolffish kininogen (XLVQPGVLI…, Table 1). The major bands of both kininog...

Ngày tải lên: 08/03/2014, 23:20

... lateral dimension of the nanowires will allow the systematic investiga- tion of size reduction effects on the electrical and gas sensing behavior of ZnO nanowires. Fig. 3. Characteristics of In 3 O 2 nanowires: ... 208–213 Synthesis and characterization of semiconducting nanowires for gas sensing G. Sberveglieri ∗ , C. Baratto, E. Comini, G. Faglia, M. Fer...

Ngày tải lên: 16/03/2014, 15:25

... Sahin et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin 1 , Janice ... E-mail: james.bibb@utsouthwestern.edu Abbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note...

Ngày tải lên: 16/03/2014, 18:20

... one-third of the PKI-inhibited activity was released into the extract, indi- cating that the precipitated Cb2 colocalized with Ca1on RIa and RIIa in a ratio of 2 : 1. Of the total PKA kin- ase activity, ... Cb2 activity in Cb2-transfected 29 3T cells was precipitated. Taken together it is there- fore reasonable to assume that Cb2 activity may consti- tute more than 20% of tot...

Ngày tải lên: 16/03/2014, 18:20

... determined by peptide sequencing are underlined. 2710 Y. Yamazaki et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Cloning and characterization of novel snake venom proteins that block smooth muscle contraction Yasuo ... property that underlies its ability to block K + -induced contractions of aortic smooth muscle and spontaneous contractions of uterine smo...

Ngày tải lên: 18/03/2014, 01:20

... Chemistry and Physics 100 (2006) 507–512 Facile synthesis and characterization of novel nanocomposites of titanate nanotubes and rutile nanocrystals Jiaguo Yu ∗ , Huogen Yu State Key Laboratory of Advanced ... the best of our knowledge, this is the first time to observe this novel morphological structure of the nanocomposites of rutile nanocrystals and titanat...

Ngày tải lên: 19/03/2014, 16:48

... spectra of PPy (a) and PPy/Zn 0.5 Cu 0.5 Fe 2 O 4 nanocomposite (b). Fig. 2. XRD patterns of PPy/Zn 0.5 Cu 0.5 Fe 2 O 4 nanocomposite (a) and the reference standard data for Zn 0.5 Cu 0.5 Fe 2 O 4 of ... kOe. 3. Results and discussions The structures of the PPy/Zn 0.5 Cu 0.5 Fe 2 O 4 nanocomposite were investigated by FTIR spectroscopy and X-ray diffraction. FTIR spectra...

Ngày tải lên: 20/03/2014, 13:08

... of purified salt-active acharan sulfate lyase The purified salt-active acharan sulfate lyase degraded heparin and heparan sulfate as well as acharan sulfate (Table 5). The salt-active acharan sulfate ... lyase II. Keywords: Bacteroides stercoris HJ-15; salt-active acharan sulfate lyase; acharan sulfate lyase; acharan sulfate; heparin. Hepari...

Ngày tải lên: 23/03/2014, 21:20

... et al.(Eur. J. Biochem. 270) Ó FEBS 2003 Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis Shiroh Iwanaga 1 , Masakazu ... inhibition of thrombin by antithrombin III [13] and heparin cofactor II [14]. Furthermore, both exosites areinvolvedintherecognitionoffactorVandfactorVIII by throm...

Ngày tải lên: 31/03/2014, 01:20

... Purification and characterization of novel chondroitin ABC and AC lyases from Bacteroides stercoris HJ-15, a human intestinal anaerobic bacterium Sung-Woon Hong 1 , Byung-Taek Kim 1 , Ho-Young ... previously purified chondroitin lyases. In conclusion, this is the first report on the purification and characterization of chondroitin ABC and A...

Ngày tải lên: 31/03/2014, 23:20

... 1:26 http://www.amb-express.com/content/1/1/26 Page 9 of 11 ORIGINAL Open Access Purification and characterization of novel fibrinolytic proteases as potential antithrombotic agents from earthworm Perionyx excavatus Tram ... 41(11):1068–73. doi:10.1186/2191-0855-1-26 Cite this article as: Phan et al.: Purification and characterization of novel fibrin...

Ngày tải lên: 20/06/2014, 23:20

... on Wireless Communications and Networking Volume 2007, Article ID 31647, 3 pages doi:10.1155/2007/31647 Editorial Novel Techniques for Analysis and Design of Cross-Layer Optimized Wireless Sensor ... process, and represent the state of the art on cross-layer design for WSNs. All of them take into account the unique peculiarities, advantages, and short...

Ngày tải lên: 22/06/2014, 19:20

... Information and Learning Company. Synthesis and Characterization of Novel Polymers for Functional and Stimuli Responsive Silicon Surfaces Kalpana Viswanathan ABSTRACT The use of polymers ... SYNTHESIS AND CHARACTERIZATION OF NOVEL POLYMERS FOR FUNCTIONAL AND STIMULI RESPONSIVE SILICON SURFACES Kalpana Viswanathan Dissert...

Ngày tải lên: 13/11/2014, 11:09

... Graduate School Department of Chemistry DESIGN, SYNTHESIS, AND CHARACTERIZATION OF POLYMERIC MATERIALS FOR USES IN ENERGY STORAGE APPLICATIONS A Thesis in Chemistry by Daniel ... numbers of other synthetic polymers were developed and commercialized in response to the growing need for new materials in the automotive and aerospace ind...

Ngày tải lên: 13/11/2014, 11:13