optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... functions of English adjectives. Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives. Chapter IV is to make a contrastive analysis between English adjectives ... in details about classification adjectives in terms of their semantic and syntactic functions of English adjectives as...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Tài liệu Project (written version):“The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” doc

Tài liệu Project (written version):“The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” doc

... 2 The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” By: Arustomjan Nona Chukhno Sergey Dubovitsky Roman Feofilaktova Yevgenja Shashkova ... other laws of Ukraine and to make this document has a legal effect). On the next stage both parties sign the contract and we think that the drivers are...

Ngày tải lên: 20/12/2013, 19:15

5 682 0
Tài liệu FACTS AND FIGURES CAUSES OF CANCER PREVENTION EARLY DETECTION CURE AND CARE CONTACTS docx

Tài liệu FACTS AND FIGURES CAUSES OF CANCER PREVENTION EARLY DETECTION CURE AND CARE CONTACTS docx

... IARC, Globocan 2002 FACTS AND FIGURES CAUSES OF CANCER PREVENTION EARLY DETECTION CURE AND CARE CONTACTS Statistics are people with the tears wiped away. Professor Irving Selikoff “ ” World Health Organization World ... America 1,570,500 Prostate Lung Colorectal Breast Lung Colorectal Prostate Lung Stomach Breast Cervix Colorectal FACTS AND FIGURES 5 FACTS...

Ngày tải lên: 15/02/2014, 05:20

15 450 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

... McNabb entered a second career in academia. He advanced to the rank of professor on the faculty at Pacific Lutheran University. He has a BA from California State College at Fullerton, an MA from ... unwillingness of managers or staff to accept change is often rooted in a culture of inertia and bureaucratic thinking. Failure or inability of an agen- cy’s management or...

Ngày tải lên: 15/02/2014, 20:20

288 2,4K 0
Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

Tài liệu Báo cáo khoa học: Looking for the ancestry of the heavy-chain subunits of heteromeric amino acid transporters rBAT and 4F2hc within the GH13 a-amylase family ppt

... scenarios reflect the ancestry of both rBATs and 4F2hc proteins anchored within the GH13 a-amylase family. The dif- ference is only in the way leading from the GH13 enzymes either to rBAT and 4F2hc together ... effort to shed more light on the early evolutionary history of the heavy-chain subunits of heteromeric amino acid transporters (hcHA...

Ngày tải lên: 18/02/2014, 13:20

14 565 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... CatD (10 ng). Values are mean SD, n ẳ 3. (Insertion: 10 ng CatE and CatD and 1 ng antigenic peptide were incubated on an ELISA plate. CatE and CatD antibodies were used for the detection at dilutions ... well). Monospesific antibodies were preincubated with different concentrations of CatE or CatD, before standard ELISA. ELISA was performed as described in Experimental pro- cedures....

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

... corresponding values of proCPY and Dgly proCPY (Fig. 2B), indicating that the precursor form was less thermally stable than the mature form, regardless of the carbohydrate moiety. After the temperature ... 6ị Results Temperature-induced unfolding of CPY and proCPY DSC analysis of Dgly proCPY revealed a perfectly sym- metrical single peak (Fig. 1A) , indicating...

Ngày tải lên: 07/03/2014, 21:20

7 439 0
Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot

Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot

... mm), and so the choice of the constant level of Fru was not critical for determination of D K m (1.23 ± 0.15). The KIE data in Table 4 are instrumen- tal in delineating the kinetic mechanism of ... order of magnitude below the s H of AfM1PDH. Discussion Kinetic mechanism of Af M1PDH and Af M2DH The theory developed by Cook and Cleland is used to deduce...

Ngày tải lên: 14/03/2014, 23:20

13 470 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... 5Â-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3Â and 5Â-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3Â, and 5Â-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3Â and 5Â-CTAGAGTTAACCCGG GATATCTTTATCGTC ... insertion of < /b> the annealed fragment of < /b> the synthesized oligonucleotides, 5Â-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGC...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

... be able to operate and sustain the new HRIS. A Local Area Network (LAN) was installed at the UNMC and staff received training about the administration and maintenance of the upgraded ICT system. Developing ... article as: Spero et al .: Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda. Hu...

Ngày tải lên: 18/06/2014, 17:20

10 535 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

... EURASIP Journal on Applied Signal Processing 2005:17, 2848–2855 c  2005 Hindawi Publishing Corporation A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal Sridhar ... INTRODUCTION The instantaneous frequency (IF) of a signal is a param- eter of practical importance in situations such as seis- mic, radar, sonar, communicat...

Ngày tải lên: 23/06/2014, 01:20

8 355 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

... DC. Phenotypic analysis of DC purity in non-matured DC cultures from roller bottle and static flask culturesFigure 4 Phenotypic analysis of DC purity in non-matured DC cultures from roller bottle ... roller bottles versus Phenotypic analysis of DC purity in matured DC cultures from roller bottle and static flask culturesFigure 5 Phenotypic analysis of DC purity in...

Ngày tải lên: 11/08/2014, 10:23

11 469 0
Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx

Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx

... functional information was available. While this is appropriate for method valida- tion, the disadvantage is that there are problems with annotation due in part to a lack of standardization, which would ... functional relationships. For any given method, there are advantages and disadvan- tages. The number of false positives and false negatives is a key measurement of accuracy. In...

Ngày tải lên: 14/08/2014, 08:20

13 388 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

... OF CALIFORNIA, SAN DIEGO Optimization of protein and RNA detection methodologies and a new approach for manipulating protein activity in living cells A dissertation submitted in partial ... xiii ABSTRACT OF THE DISSERATION Optimization of protein and RNA detection methodologies and a new approach for manipulating...

Ngày tải lên: 13/11/2014, 10:46

144 306 0
Từ khóa:
w