protein structure prediction by emphasizing local side-chain backbone ang side-chain side-chain interactions

... Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure Federica Sinibaldi, Maria C. Piro, Massimo Coletta and Roberto Santucci Dipartimento ... strength of the Met8 0– Fe(III) axial bond] of the salt-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cott...

Ngày tải lên: 19/02/2014, 05:20

... Journal compilation ê 2006 FEBS 3167 Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix Pei-Tzu Wu 1 , ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers. Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites...

Ngày tải lên: 19/02/2014, 06:20

... grammaticality of the input. In other words, instead of deciding on the grammaticality of the input, we can give an indica- tion of its grammaticality, quantified on the basis of the description of the ... gram- maticality index). 4 Grammaticality index from PG We describe in the remainder of the paper predic- tions of the model as well as the results of a psy- choling...

Ngày tải lên: 20/02/2014, 11:21

... by Lon protease (Eur. J. Biochem. 269) 453 The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli Wataru Nishii 1 , Takafumi Maruyama 1 , ... when the pre-MBP -SulA fusion protein was used as the substrate, only the SulA portion was degraded by Lon protease in an ATP-dependent manner...

Ngày tải lên: 21/02/2014, 03:20

... Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack Philip E. Morgan 1 , Roger T. Dean 2 and Michael J. Davies 1 1 EPR and 2 Cell ... Australia Reaction of certain peptides and proteins with singlet oxygen (generated by visible light in the presence of rose bengal dye) yields lo...

Ngày tải lên: 21/02/2014, 03:20

... (GraphPad Software, San Diego, CA). Acknowledgements This work was supported by grants from the Heart and Stroke Foundation of Canada (grant T4134) and the Canadian Institutes of Health Research (grant MT11270). ... exposed to film, and each spot was cut out and counted by liquid scintillation. ATP hydrolysis and TLC ATP hydrolysis was determined by measuring the re...

Ngày tải lên: 07/03/2014, 09:20

... RT-PCR using total RNA separated from mix stage of C. elegans as a template with the following primers: M2- goa1-s, 5Â- CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3Â; M2- goa1-PstI-as, ... M 2 in the GOA-1 fusion protein is functional, and the ligand-binding properties agree with that of the Ga i1 fusion protein. Activation of GOA-1 by muscarinic...

Ngày tải lên: 07/03/2014, 11:20

... compilation ê 2010 FEBS CHIP participates in protein triage decisions by preferentially ubiquitinating Hsp70-bound substrates Marta Stankiewicz 1 , Rainer Nikolay 1, *, Vladimir Rybin 2 and Matthias ... ubiquitin themselves but generally bring substrates and E2 ubiquitin-conjugating enzymes in close proximity by binding to both proteins. It has been shown that CH...

Ngày tải lên: 15/03/2014, 23:20

... supported by FAPESP, FUNDUNESP, CNPq and LNLS. N1- 034P Amyloid oligomers: structure and function L. A. Morozova-Roche Department of Medical Biochemistry and Biophysics, Umea ˚ Uni- versity, Umea, ... moieties of NAAD and NAD, F170 and residues 22 4–2 28, which may be triggered by dif- ferential coordination of a magnesium ion to NAAD and NAD. N1- 022P Identification of ami...

Ngày tải lên: 23/03/2014, 15:20

... secondary -structure: helix-strand-strand- helix-strand-strand (H-E-E-H-E-E). Assume that you find a protein of known structure with the same motif (H-E-E-H-E-E). Can you conclude that the two proteins ... secondary- structure motif H-E-E-H-E-E. Multiple Sequence Alignment 1 1 From: Methods in Molecular Biology , vol. 143: Protein Structure Prediction: Methods and Protocols E...

Ngày tải lên: 08/04/2014, 12:52

... protein structures with the target protein sequence SVNY330-Xu-Vol-I November 4, 2006 10:1 Ying Xu, Dong Xu, and Jie Liang (Eds.) Computational Methods for Protein Structure Prediction and Modeling Volume ... pipelines for structure determination reached efforts on computational structure prediction. Threading and comparative modeling meth- ods have alrea...

Ngày tải lên: 27/06/2014, 10:20

... partners of protein B. The total number of ways for the two interacting proteins to have n and m interaction partners, regardless of how many are in common, is given by . Therefore, the probability ... respectively (n and m are also called degrees of A and B). A standard model of a protein interaction type network is the fixed-degree-sequence random graph [...

Ngày tải lên: 14/08/2014, 08:20

Ngày tải lên: 13/11/2014, 10:21