... Journal of Water and Environment Technology, Vol.3, No.2, 2005 - 289 - Isolation and characterization of an extracellular polymer closely related to flocculation of activated sludge ... determination of hexosamines according to Elson and Morgan. Acta Chem. Scand., Vol.2, 467-473. Blumenkrantz, N. and Asboe-Hansen, G. (1973) New method for qua...
Ngày tải lên: 05/09/2013, 09:08
... amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, ... Journal 276 (2009) 59835997 ê 2009 The Authors Journal compilation ê 2009 FEBS Functional characterization of an orphan cupin protein from Burkholderia xenovorans...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... BMP -R-Smad ortholog from S. mansoni FEBS Journal 274 (2007) 40754093 ê 2007 The Authors Journal compilation ê 2007 FEBS 4093 Identification and characterization of an R-Smad ortholog (SmSmad1B) from ... parasite Schistosoma mansoni has a complex life cycle consisting of both free-living and host-dependent stages. The signaling mechanisms underlying the grow...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... FEBS Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima Leon D. Kluskens 1 , Gert-Jan W.M. van Alebeek 2 , Jasper Walther 1 , ... Molecular and bio- chemical characterisation of the thermo-active family 1 pectate lyase from the hyperthermophilic bacterium Thermotoga maritima. Bio...
Ngày tải lên: 20/02/2014, 03:20
Tài liệu Báo cáo Y học: Characterization of an omega-class glutathione S-transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities pptx
... 269) Ó FEBS 2002 Characterization of an omega-class glutathione S -transferase from Schistosoma mansoni with glutaredoxin-like dehydroascorbate reductase and thiol transferase activities Javier ... transferase enzymatic activities. Keywords: glutathione S -transferase; dehydroascorbate reductase; thiol transferase; Schistosoma. Glutathione S...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... represent the average of duplicate wells. Ó FEBS 2003 An IgNAR variable domain specific for human Tom70 (Eur. J. Biochem. 270) 3549 Isolation and characterization of an IgNAR variable domain specific for ... degree of affinity and specificity for Tom70, andwithaK D of 2n M compares very well with affinities reported for camelid V H H domains (...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Characterization of an N6 adenine methyltransferase from Helicobacter pylori strain 26695 which methylates adjacent adenines on the same strand pptx
... MTase from H. pylori 26695 [20]. In the case of the FokI MTase, two domains are responsible for methylating two adenine residues – one in the upper strand and one in the lower strand [24].Yet another ... concentration of [ 3 H]Ado- Met in the range of 0.3–2.4 lm while keeping the DNA concentration fixed at 50 nm and keeping other reaction conditions identical. Th...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: Identification and functional characterization of an aggregation domain in long myosin light chain kinase ppt
... Tumor necrosis factor-induced long myosin light chain kinase transcription is regulated by differentiation-dependent signaling events: characterization of the human long myosin light chain kinase promoter. ... N-terminal extension of the isoform of smooth muscle long myosin light chain kinase. Cell Res 16, 367–376. Aggregation domain in myosin lig...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo sinh học: "Construction and characterization of an infectious clone of coxsackievirus A16" docx
... produced from the cDNA clone. The resultant transcripts were used to transfect RD cells. At 72 h post-transfection, cells and supernatants were harvested and analyzed by microscopy and biochemical ... and testing of candidate live attenuated vaccines and antiviral therapeutics against CVA16. Methods Cells and viruses RD and Vero cells were grown in DMEM (Gibco, Grand Is...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Construction and characterization of an infectious clone of coxsackievirus A16" ppt
... first construction and characterization of an infectious cDNA clone of CVA16. The availability of this infectious clone will greatly enhance future virological investigations and vaccine development ... Tan XJ, Wang HY, Yan DM, Zhu SL, Wang DY, Ji F, Wang XJ, Gao YJ, Chen L, et al: An outbreak of hand, foot, and mouth disease associated with subgenotype C4 of...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx
... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850 , respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823 ; AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGG...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Characterization of an H10N8 influenza virus isolated from Dongting lake wetland" potx
... waterfowl, mainly wetland, is very important for early detection of avian influenza virus. The epidemiology investigation of avian influenza virus was performed in Dongting lake wetland which is an international ... investigation of water in Donting Lake wetland for avian influenza virus is of greater significance and convenience for understanding the route and mech...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx
... was employed to evaluate the cross reactivity between paren- tal(190Asp)andHA-mutant(190Ala)TK04viruses. Additionally, cross reactivity was evaluated between TK04 parental and mutant viruses, and other ... turkey H3N2 influenza isolates. More work is needed to evaluate the replication and antigenicity of 190Ala mutation in vivo . Addition- ally, it is of importance to see...
Ngày tải lên: 12/08/2014, 01:22
báo cáo khoa học: " Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)" ppt
... methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish) Nobuya Itoh*, Hiroshi Toda, ... major source of these compounds in the atmosphere; however, there are few reports about the halide profiles and strengths of these emissio...
Ngày tải lên: 12/08/2014, 03:21
taxonomic characterization of an acidophilic bacterium
... 1 Taxonomic characterization of an acidophilic bacterium isolated from the acidophilic nitrifying process 2009 MASTER OF ENGINEERING NGUYEN HUYEN THI THANH Student ... TOYOHASHI UNIVERSITY OF TECHNOLOGY 2 Taxonomic characterization of an acidophilic bacterium isolated from the acidophilic nitrifying process Abstract...
Ngày tải lên: 13/11/2014, 06:08