development of a remote medical image browsing and interaction system
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the ... Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests...
Ngày tải lên: 28/10/2013, 11:15
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former, and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA GGGG-3Â ... long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwat...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... using primers (5Â-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3Â), and checked for the presence and ... (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG CCTGCAGGTCGACTCTAGAGGATCT...
Ngày tải lên: 07/03/2014, 16:20
Development of a DTPA soil test for zinc, iron, manganese, and cropper
...
Ngày tải lên: 15/03/2014, 23:56
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate Judit Marokha ´ zi 1 , Nikolett Mihala 2 , Ferenc Hudecz 2,3 , Andra ´ s ... the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity on th...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... Access Research Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland John F Menton*, Karen Kearney and John G Morgan Address: ... hospitals. Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Development of a parent version of the Manchester-Minneapolis quality of life survey for use by parents and carers of UK children: MMQL-UK (PF)" potx
... (subjects and controls) and their parents or those with parental responsibilities (for children less than 16 years of age), following oral and written explanation of the study. Analysis Data were analysed ... shortened and anglicised version of the MMQL- UK (CF). This paper concentrates specifically on the vali- dation of the MMQL -UK (PF) and comparison with...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. Discussion We have developed a TaqMan probe-based QPCR assay to quantitate the viral load of macaque rhadinoviruses belonging ... assay. The RV-2 QPCR assay was negative for these templates under the standard reaction conditions. Identification of a novel RV2...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
... found that all positives belonged to the GII/4 variant of NoV. Conclusion: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method ... Central Page 1 of 8 (page number not for citation purposes) Virology Journal Open Access Research Development of a real-time RT-PCR and Reverse Li...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot
... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. Discussion We have developed a TaqMan probe-based QPCR assay to quantitate the viral load of macaque rhadinoviruses belonging ... templates in the RV2 assay. The RV-2 QPCR assay was negative for these templates under the standard reaction conditions. Identifi...
Ngày tải lên: 20/06/2014, 04:20
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx
... says, you should change what you can and accept what you can’t change and try to make the best of it. Believe me, it can be done with the right clothing, makeup, hairstyle, and self-care. The ... can work for every season and occasion. If you, The cloThes Make The Manager 41 ment bag. If you want to make it a bit more interesting, you can buy...
Ngày tải lên: 21/06/2014, 03:20
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx
... when they meet you is your eyes and face. Your clothes and hair aren’t the stars; you are! Be careful not to create what I call a visual assault. Examples of visual assaults include huge, gaudy ... Tall or Too Small I can’t say this enough: Whatever your body challenges are, and we all have them, the right clothing will help you enhance your assets and camouflage your...
Ngày tải lên: 21/06/2014, 03:20
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc
... important factor in arriv- ing at first impressions. The participants included Caucasians, African-Americans, Latinos, and Asians between the ages of 20 and 60. As expected, clothes and face topped ... by standing in front of a friend and saying your name. Then, move an arm’s length away, and continue saying your name so your friend can hear you. Put your hands on you...
Ngày tải lên: 21/06/2014, 03:20
Design and development of a medical parallel robotfor cardiopulmonary resuscitation
... translational parallel manipulator was chosen and designed to satisfy the specific requirement. The kinematic analysis was performed and the manipulator- reachable workspace was generated by taking ... variable R and allows the calculation of the values of R and H in sequence. B. Design Variables and Objective Function The architectural parameters of a 3-PUU TPM involve t...
Ngày tải lên: 04/08/2014, 09:54
development of a remote medical image browsing and interaction system
... benefits of more and more human interaction and collaboration. 11 Chapter 3 Remote Image Browsing Capability More and more people complain that hospitals or clinics are too far away from the medical ... part and image- view interaction part. Some important algorithms and techniques at the heart of the JPEG 2000 image compression standard are studied. The softwar...
Ngày tải lên: 30/10/2014, 20:06