application of committee k-nn classifiers for gene expression profile classification

Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11

Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11

... – Application of House’s model for translation quality assessment In this chapter, House’s model for translation quality assessment will first be presented and then applied in assessing the English ... translation of the Law on Investment 2005 of Vietnam. Chapter 3 – Discussion of results and implications Findings about the quality...
Ngày tải lên : 07/11/2012, 14:36
  • 86
  • 896
  • 5
Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent

Application of Ozone/UV Process for the Reclamation of Sewage Treatment Plant Effluent

... combination (ozone/UV) process is applied for the reuse of sewage effluent. Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment of sewage effluent ... to evaluate the ozone and UV combination (ozone/UV) process for the reuse of sewage treatment plant effluent. The ozone/UV process...
Ngày tải lên : 05/09/2013, 08:40
  • 13
  • 606
  • 1
Báo cáo khoa học: Diverging regulation of pyruvate dehydrogenase kinase isoform gene expression in cultured human muscle cells pot

Báo cáo khoa học: Diverging regulation of pyruvate dehydrogenase kinase isoform gene expression in cultured human muscle cells pot

... and hPDK4 gene expression FEBS Journal 272 (2005) 30043014 ê 2005 FEBS 3007 Diverging regulation of pyruvate dehydrogenase kinase isoform gene expression in cultured human muscle cells Emily L. ... protein kinase kinase (MEK) inhibitor, U0126 [32,33]. Therefore, the role of the MAPK pathway in regulating PDK mRNA expression was investigated by incubati...
Ngày tải lên : 07/03/2014, 17:20
  • 11
  • 316
  • 0
Báo cáo khoa học: "The Acquisition and Application of Context Sensitive Grammar for English" docx

Báo cáo khoa học: "The Acquisition and Application of Context Sensitive Grammar for English" docx

... The Acquisition and Application of Context Sensitive Grammar for English Robert F. Simmons and Yeong-Ho Yu @cs.texas.edu Abstract Department of Computer Sciences, AI Lab University of Texas, ... parsing and rapid acquisition of CSG from example parsings of newspaper stories. Chomsky[1957] defined a hierarchy of grammars in- cluding context- free and...
Ngày tải lên : 31/03/2014, 06:20
  • 8
  • 478
  • 0
báo cáo hóa học:" Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes" pptx

báo cáo hóa học:" Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes" pptx

... purposes) Journal of Translational Medicine Open Access Research Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ- responsive genes Xie ... also contributed to TGFβ activation in glioblastomas. In addi- tion, genes involved in antigen presentation were upregu- lated in the...
Ngày tải lên : 18/06/2014, 15:20
  • 11
  • 659
  • 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

... reproduction in any medium, provided the original work is properly cited. Research Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate ... that identified the candidate biomarkers, and they participated in the data analyses. AAH developed the customized Spotfire tool used for...
Ngày tải lên : 18/06/2014, 16:20
  • 13
  • 528
  • 0
Báo cáo hóa học: " Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus" potx

Báo cáo hóa học: " Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus" potx

... telomeric repeat-binding protein 1 (TRP1), which also contains the typical MYB motifs [26]. Eight out of these nine genes were also included in the response to auxin stimulus, being At1g71030 (MYBL2) the missing ... suggest that they are often involved in combinatorial interactions with other transcription fac- tors for the generation of highly specific expression pat- ter...
Ngày tải lên : 20/06/2014, 01:20
  • 11
  • 436
  • 0
Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx

Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx

... of pcDNA3.1(+)-FLAG- tagged expression vector [43]. Primers for NS3/4A; 5'- AAGGGGGGATCCACCATG GCGCCCATCACGGCG- TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', ... 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAA...
Ngày tải lên : 20/06/2014, 01:20
  • 13
  • 475
  • 1
Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx

Báo cáo hóa học: " Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics" potx

... 1:3 http://www.hcis-journal.com/content/1/1/3 Page 2 of 14 RESEARCH Open Access Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics Masahiro ... Measurement. Proc. of INFOCOM-2007, Demo Session doi:10.1186/2192-1962-1-3 Cite this article as: Hiyama et al.: Application of a MANET...
Ngày tải lên : 21/06/2014, 06:20
  • 14
  • 471
  • 0
Báo cáo nghiên cứu khoa học: "Application of hydro-mathematical models for flood forecast and inundation warning of Tra Khuc-Ve River basins" potx

Báo cáo nghiên cứu khoa học: "Application of hydro-mathematical models for flood forecast and inundation warning of Tra Khuc-Ve River basins" potx

... inundation warning for Tra Khuc and Ve river basins Scheme for connection of flood forecasting and inundation warning is shown in Figure 2. Figure 2. Scheme for flood forecasting and inundation warning ... and Huynh Lan Huong, Study on the option for the flood forecasting and inundation warning of Tra Khuc – Ve Rivers. Summary Report...
Ngày tải lên : 21/07/2014, 16:21
  • 7
  • 323
  • 0
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc

Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc

... Access ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data Brad A Friedman 1,2,3* and Tom Maniatis 4 Abstract RNA-Seq and microarray platforms have ... ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data Friedman and Maniatis Friedman and Maniat...
Ngày tải lên : 09/08/2014, 23:20
  • 12
  • 394
  • 0
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

... includes base 10 log-transformation as well as normalization to mean 0 and variance 1. For the data that contains negative values, we do not perform log-transformation. In microarray data, the gene ... classification. Both ANMM and CBR are suitable for dealing with microarray data, which usually contain noisy information and only a small number of training samples are available. Y...
Ngày tải lên : 12/08/2014, 17:20
  • 11
  • 373
  • 0
application of committee k-nn classifiers for gene expression profile classification

application of committee k-nn classifiers for gene expression profile classification

... Fulfillment of the Requirements for the Degree Master of Science Manik Dhawan December, 2008 ii APPLICATION OF COMMITTEE k-NN CLASSIFIERS FOR GENE EXPRESSION PROFILE CLASSIFICATION ... APPLICATION OF COMMITTEE k-NN CLASSIFIERS FOR GENE EXPRESSION PROFILE CLASSIFICATION A Thesis Presented to The Graduate Faculty of The...

Xem thêm