analysis and design of reinforced and prestressed-concrete g

SAP2000® Linear and Nonlinear Static and Dynamic Analysis and Design of Three-Dimensional Structures

... 1 - 2 Overview of the Program 1 Overview of the Program SAP2000 is a stand-alone finite-element-based structural program for the analysis and design of civil structures. It offers an intuitive, ... Assign, Analyze, Display and Design. These listed menus contain the commands that will be needed most often when using SAP2000, and many of the most frequently used comman...

Ngày tải lên : 06/09/2012, 15:56

47
1.4K
2

SAP2000 Integrated Finite Elements Analysis and Design of Structures

... Computers and Structures, Inc. Berkeley, California, USA Issue Date: June 1998 Revision Number : 0 Revision Date: N/A SAP2000  Integrated Finite Elements Analysis and Design of Structures SAP2000 ... a registered trademark of Computers and Structures, Inc. SAP2000 is a registered trademark of Computers and Structures, Inc. Windows is a registered trademark...

Ngày tải lên : 06/09/2012, 15:56

127
1.5K
2

Theory and Design of Electrical and Electronic Circuits

... /2)1/2 Theory and Design of Electrical and Electronic Circuits Index Introduction Chap. 01 Generalities Chap. 02 Polarization of components Chap. 03 Dissipator of heat ... necessary Theory and Design of Electrical and Electronic Circuits _________________________________________________________________________________ Introd...

Ngày tải lên : 23/10/2013, 16:15

493
797
6

Electronics - Theory and Design of Electrical and Electronic Circuits

... Polarization of components Bipolar transistor of junction (TBJ) Theory Design Fast design Unipolar transistor of junction (JFET) Theory Design Operational Amplifier of Voltage (AOV) Theory Design ... copper of the wire of the primary R 2 resistance of the copper of the wire of the secondary R 0 resistance of losses for Foucault and hysteresis C 1 di...

Ngày tải lên : 27/10/2013, 16:15

493
734
2

Analysis and design of control systems using MATLAB

Ngày tải lên : 01/01/2014, 18:43

269
657
2

Tài liệu bruhn analysis and design of flight vehicles structures pptx

Ngày tải lên : 13/02/2014, 20:20

300
1.1K
0

Tài liệu Obesity guidance on the prevention, identification, assessment and management of overweight and obesity in adults and children ppt

... catering (including vending machines) and the food and drink children bring into school, the taught curriculum (including PE), school travel plans and provision for cycling, and policies relating ... Section 3 on pages 59 and 60 has links to tools to help with implementing the recommendations, meeting training needs, evaluating the impact of action and working...

Ngày tải lên : 21/02/2014, 11:20

84
1.1K
0

Obesity guidance on the prevention, identification, assessment and management of overweight and obesity in adults and children docx

... evidence of effectiveness, including cost effectiveness. They include recommendations on the clinical management of overweight and obesity in the NHS, and advice on the prevention of overweight and ... overweight and obesity in adults and children in England and Wales. The guidance aims to: ã stem the rising prevalence of obesity...

Ngày tải lên : 22/03/2014, 09:20

84
709
0

chemical engineering design principles, practice and economics of plant and process design

... FUNDAMENTALS OF MATERIAL BALANCES Gavin Towler is the Senior Manager of Process Design, Modeling and Equipment at UOP LLC. He manages the areas of process design and optimization, equipment design, and ... commercial process. Even here, most of the unit operations and process equipment will use established designs. The majority of process designs are based on d...

Ngày tải lên : 01/04/2014, 11:33

1.3K
411
0

báo cáo hóa học:" Uncontrolled asthma: assessing quality of life and productivity of children and their caregivers using a cross-sectional Internet-based survey" ppt

... 8:96 http://www.hqlo.com/content/8/1/96 Page 5 of 10 RESEARC H Open Access Uncontrolled asthma: assessing quality of life and productivity of children and their caregivers using a cross-sectional Internet-based survey Bonnie B Dean 1* , ... 8:96 http://www.hqlo.com/content/8/1/96 Page 9 of 10 asthma, the mean response of caregivers of children w...

Ngày tải lên : 20/06/2014, 16:20

10
512
0

Báo cáo khoa học: " Effect of ultraviolet radiation on the hatchability and survival of eggs and larvae of sheep nematode" doc

... (2004), / 5 (1), 59–62 Effect of ultraviolet radiation on the hatchability and survival of eggs and larvae of sheep nematode Ademola Isaiah Oluwafemi* and Ademola Janet Ayobami 1 Department of Veterinary ... of change in UV radiation intensities base on length of exposure on the hatching of nematode eggs as well as the survival rate of...

Ngày tải lên : 07/08/2014, 17:22

4
373
0

báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx

... et al.: Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G > A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic ... tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgt...

Ngày tải lên : 10/08/2014, 10:21

9
356
0

Báo cáo khoa học: " Pyelonephritis in slaughter pigs and sows: Morphological characterization and aspects of pathogenesis and aetiology" pptx

... 52:48 http://www.actavetscand.com/content/52/1/48 Page 9 of 10 RESEARC H Open Access Pyelonephritis in slaughter pigs and sows: Morphological characterization and aspects of pathogenesis and aetiology Louise K Isling 1* , ... purpose of the present study was to describe the morphology, investigate the pathogenesis, and evaluate the aetiological role of E. c...

Ngày tải lên : 12/08/2014, 18:22

10
364
0

analysis and design of reinforced concrete bridge structures

... 5) modulus of elasticity of concrete modulus of elasticity of concrete at transfer of stress modulus of elasticity of prestressing strand modulus of elasticity of steel flexural stiffness of compression ... 343 on Concrete Bridge Design, provide currently acceptable guidelinesfor the analysis and design of reinforced, prestressed, and partially prestres...

Ngày tải lên : 24/10/2014, 16:04

158
755
1

analysis and design of reinforced and prestressed-concrete guideway structures

... Kokkins Andy Moucessian Andrzej S. Nowak Henry G. Russell These recommendations, prepared by Committee 358, present a procedure for the design and analysis of reinforced and prestressed-concrete guideway ... ACI 358.1R-92 ANALYSIS AND DESIGN OF REINFORCED AND PRESTRESSED-CONCRETE GUIDEWAY STRUCTURES Reported by ACI Committee 358 Hidayat N. Grouni ......

Ngày tải lên : 24/10/2014, 21:58

35
463
0