... Design and development of major balance of plant components in solid oxide fuel cell system Wen-Tang Hong 1 , Tzu-Hsiang Yen 2 , Cheng-Nan Huang 1 , Hsueh-I Tan 1 , Yu Chao 1 1 Institute ... and mass flow rate in the major BOP components so as to identify potential design improvements in the INER SOFC system in the future. In practice...
Ngày tải lên: 05/09/2013, 16:10
... using primers (5Â-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3Â), and checked for the presence and ... (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG CCTGCAGGTCGACTCTAGAGGATCT...
Ngày tải lên: 07/03/2014, 16:20
history and development of higher education in india 1 5 ppt
...
Ngày tải lên: 09/03/2014, 17:20
the relationship between corporate social responsibility implementation and the development of five selected companies in hanoi
... SOCIAL RESPONSIBILITY IMPLEMENTATION AND THE DEVELOPMENT OF FIVE SELECTED COMPANIES IN HANOI By HO PHAM QUYNH NGA April 2011 Supervisor: Dr. Pham Duc Hieu ABSTRACT Corporate social responsibility ... managers in order to explore their idea about CSR and the relationship between CSR implementation and the development of company. 3.3 D...
Ngày tải lên: 13/03/2014, 14:20
ORIGIN AND DEVELOPMENT OF FORM AND ORNAMENT IN CERAMIC ART pptx
... ornaments in pottery 458 Non-ideographic elements of decoration 453 Origin and development of form and ornament in ceramic art (W.H. Holmes) 437- 465 Origin of ornament in pottery 453 Ornament in ... painted upon pottery 463 488.—Theoretical development of fret work 464 489.—Theoretical development of scroll work 465 [Pg 443] ORIGIN AND...
Ngày tải lên: 28/03/2014, 20:20
a comparative analysis of the cognitive moral development of independent public auditors in selected public accounting firms and bank examiners in selected federal banking regulatory agencies
... Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without ... permission. Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Reproduced with permission of the copyright owner. Further repr...
Ngày tải lên: 03/06/2014, 02:11
Ministry of Agriculture and Rural Development: Analysis of Technical, Economic and Social Indicators and Assessment of Technical Adoption Rate in Clam Aquaculture Households - MS10 " pot
... 11 3.1.2.4 Household clam culture training The information about technical training, training quality and rate of technical application were showed in the Table 6. 84.2% of households in the project ... diversification of livelihoods of the poor coastal communities in Central Vietnam MS 10: Project Validation Report Analysis of Technical, Economic and...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs " pptx
... Progress Report Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs. Date 30/06/2006 ... trained in ELISA techniques for the detection of FMD antigen and antibody and the standardisation of reagents. Training was carried o...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 3 " pptx
... improve the diagnostic capability of the veterinary laboratories in Vietnam and the training of DAH veterinarians in disease investigation and control. This will strengthen the profile of DAH ... Australia and internationally through the training programs and also through the achievements in understanding FMD in Vietnam. FMD is a disease of import...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 6 " ppt
... Australia and internationally through the training programs and also through the achievements in understanding FMD in Vietnam. FMD is a disease of importance in Vietnam and the region and this ... of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs Milestone 6 Epidemio...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo nghiên cứu khoa học " Development of Improved Capability in Support of National Biosecurity for the upport Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 8" pptx
... conducted at the start of the project, on-going OIE workshops and highly effective on -the- job “hands-on” training of DAH personnel in the field during the course of the project. The successful ... control of FMD in Vietnam. For example, in the 2006/2007 period the sequencing and genotyping of FMD field isolates was performed and highlighted the o...
Ngày tải lên: 22/06/2014, 12:20
Báo cáo khoa học: "Growth and development of individual Douglas-fir in stands for applications to simulation in silviculture" potx
... growth and height Original article Growth and development of individual Douglas-fir in stands for applications to simulation in silviculture JM Ottorini INRA-Nancy, Station de ... involved in the growth and development of a tree in a stand ,and Inose (1982), a limited linear one. Our con- text being more similar to that of th...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo sinh học: "Support for single major genes influencing fat androstenone level and development of bulbo-urethral glands in young boars MN Fouilloux" potx
... finding of a major gene affecting fat androstenone level gives rise to new prospects for reducing incidence of boar taint by means of breeding. The average level of individuals ... results of a selection experiment based on an index associating fat androstenone level and bulbo-urethral gland size. In: Measurement and Prevention...
Ngày tải lên: 09/08/2014, 18:22
bond and development of straight reinforcing bars in tension
... factor of 0.8 for small bars and addressing the negative impact on bond reliability of changing the load factors while maintaining f c ′ BOND AND DEVELOPMENT OF STRAIGHT REINFORCING BARS IN TENSION ... Jirsa 0.1 c max c min 0.9+ 1.25≤ BOND AND DEVELOPMENT OF STRAIGHT REINFORCING BARS IN TENSION 408R-11 and Breen 1977; Darwin and Graham...
Ngày tải lên: 24/10/2014, 17:25
splice and development length of high relative rib area reinforcing bars in tension
... 408.3-2 4.0 Development of high relative rib area reinforcing bars in tension, p. 408.3-2 5.0—Splices of high relative rib area reinforcing bars in tension, p. 408.3-3 David Darwin Chairman Adolfo B. ... ad- vantage of high relative rib area on the tension splice and de- velopment length of reinforcing bars. It includes an expression f...
Ngày tải lên: 24/10/2014, 22:00