GTAG: A Lexicalized Formalism for Text Generation inspired by Tree Adjoining Grammar
Tài liệu Báo cáo khoa học: "Outilex, a Linguistic Platform for Text Processing" pdf
... naturelles), page to appear, Leu-
ven. ATALA.
Eric Brill. 1995. Transformation-based error-driven
learning and natural language processing: A case
study in part-of-speech tagging. Computational Lin-
guistics, ... the form of recursive automata
(automata that call other automata). The termi-
nal symbols are lexical masks (Blanc and Dister,
2004), which are underspecified word tags i.e. that
r...
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... 5 Summary and
Outlook
Discourse markers, words that signal the pres-
ence of a coherence relation between adjacent
text spans, play important roles in human text
understanding and production. ...
though. As we have illustrated above and will
elaborate below, these words can carry a wide
variety of semantic and pragmatic overtones,
which render the choice of a...
Tài liệu Báo cáo khoa học: "Some Novel Applications of Explanation-Based Learning to Parsing Lexicalized Tree-Adjoining Grammars"" doc
... Some Novel Applications of Explanation-Based Learning to
Parsing Lexicalized Tree-Adjoining Grammars"
B.
Srinivas and Aravind
K. Joshi
Department of Computer and Information ...
tectures to show the effectiveness of our ap-
proach.
1 Introduction
In this paper we present some novel applications of
the so-called Explanation-Based Learning techniq...
Báo cáo khoa học: "A Tree Transducer Model for Synchronous Tree-Adjoining Grammars" pdf
... (2009) for a more
detailed exposition to XTT.
5 Synchronous tree- adjoining grammar
XTT are a simple, natural model for tree trans-
formations, however they are not suitably ex-
pressive for all ... generally do not dis-
cuss trees with error symbols explicitly.
4 Extended tree transducer
An extended tree transducer is a theoretical model
that computes a tree transfor...
Báo cáo khoa học: "Encoding Lexicalized Tree Adjoining Grammars with a Nonmonotonic Inheritance Hierarchy" potx
...
the tree nodes are labeled with syntactic categories
and feature information and there is at least one
leaf node labeled with a lexical category (such lexi-
cal leaf nodes are known as anchors). ... above.
an encoding of (largely equivalent) lexical rules that
are an integral part of a nonmonotonic inheritance
hierarchy that stands as a description of all the ele-
ment...
Báo cáo khoa học: "Extraction of Tree Adjoining Grammars from a Treebank for Korean" pdf
... grammar
development have been taken during last decades.
Automatic grammar development means that a
system extracts a grammar from a Treebank which
has an implicit Treebank grammar. The grammar ... we extract TAG grammars and tree
schemata. Above all, full-scale syntactic
tags and well-formed morphological analy-
sis in Sejong Treebank allow us to extract
syntactic fe...
Báo cáo khoa học: "Discourse Structures for Text Generation" doc
...
in a text. The
pattern of instantiation of schemas in a text is called a
text
structure.
So, for our example text, one part of its text structure
says that the text span of the whole text ... more comprehensive and more informative about text
function than the text organization parts of previous text
generation systems.
1,
The Text Organization Problem
Text ge...
Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc
... trees. As Kmch and Jmhi
point out, this means that a TAG is incomplete ms an
account of the structure of a natural language, e.g. a TAG
grammar
wW
contain ~th an
active
and
a passive
form ... Adj~g Grammars, or "TAG's', (Josh/, Levy &
Takahash/
1975;
Josh/ 1983; Kroch & Josh/ 1965) we~
developed as an al~ma~ive
to
the aandard tyntac~
formalism...
Báo cáo khoa học: "SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction" pptx
... 13–16,
Prague, June 2007.
c
2007 Association for Computational Linguistics
SemTAG: a platform for specifying Tree Adjoining Grammars and
performing TAG-based Semantic Construction
Claire Gardent
CNRS ... tree adjoining grammars. In
Proceedings of LACL05, Bordeaux, France.
A. Joshi and Y. Schabes. 1997. Tree- adjoining gram-
mars. In G. Rozenberg and A. S...
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... data
analysis and the preparation of the manuscript. MJS supervised the study plan-
ning, data analysis and preparation of the manuscript. All authors read and
approved the final manuscript.
Acknowledgements
The ... reproduction in any
medium, provided the original work is properly cited.
Technical Note
A rapid method for the generation of uniform
acellula...
Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf
... such as a cellular phone, a GPS
receiver, an MP3 player, an e-book reader, a digital camera,
a portable television, a satellite radio, a handheld gaming
platform, and so forth. This concept also ... program 4 execution
Unit chip 2: program 2 execution
Unit chip 3: program 3 execution
Data
frame
buffer
Data
frame
buffer
Data
frame
buffer
Data
frame
buffer
Data
memory
Data
memory
Data
m...
Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt
... variables at the
output of the Rayleigh simulator may have arbitrary values,
depending on the variances of the Gaussian random variables
at the inputs of Doppler filters as well as the characteristics ... random variables (with Rayleigh
fading envelopes) is achieved.
In addition, note that the variance of the jth Gaussian
random variable in Z is the jth ele...
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf
... Access
FusionSeq: a modular framework for finding gene
fusions by analyzing paired-end RNA-sequencing
data
Andrea Sboner
1,2†
, Lukas Habegger
1†
, Dorothee Pflueger
3
, Stephane Terry
3
, David ... of each pri-
mer (forward, TMPRSS2 exon 1 - TAGGCGC
GAGCTAAGCAGGAG; reverse, ERG exon 5 -
GTAGGCACACTCAAACAACGACTGG; as published
by Tomlins et al. [23]) and 50 ng cDNA at...
GTAG: A Lexicalized Formalism for Text Generation inspired by Tree Adjoining Grammar
... G-TAG: A Lexicalized Formalism for
Text Generation inspired by Tree
Adjoining Grammar
LAURENCE DANLOS
TALANA, Université Paris 7 & LORIA
Introduction
G-TAG is a formalism to generate texts ... & Joshi 1998) have proposed also a TAG grammar for text.
Their approach will be compared with mine in Section 6.
8 / G-TAG : a Lexicalized Formalism for...