Measures to promote the reform of administrative procedures in the operation of the public universities in vietnam (Sum)

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... of the sole Glyco_18 domain, the C-terminal tail of C. gigas CLPs may not noticeably contribute to the structure and the function of these proteins. Interestingly, Cg-Clp1 and Cg-Clp2 C-terminal ... Oyster chitinase-like proteins FEBS Journal 274 (2007) 36463654 ê 2007 The Authors Journal compilation ª 2007 FEBS 3651 Characterization of chitinase-like protei...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

... cycle-related changes in biological activity of moult- inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript J. Sook Chung and Simon ... determining the inhibitory action of MIH and CHH on the target tissue, receptor binding, a second messenger pathway, MIH and...

Ngày tải lên: 21/02/2014, 00:20

9 588 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5Â-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3Â and 5Â-GCGGCATGCT CA GTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3Â (His-tag underlined); PSAG with ... FEBS Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of...

Ngày tải lên: 07/03/2014, 21:20

9 422 0
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

... Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues Marilyne Stuart-Audette 1 , ... technique. The bityrosine signal was observed in all peptides containing tyrosine 23 or 53 but not in peptides containing tyrosine 20 alone. According to these...

Ngày tải lên: 17/03/2014, 10:20

7 475 0
Báo cáo khoa học: Diversity of human U2AF splicing factors Based on the EMBO Lecture delivered on 7 July 2005 at the 30th FEBS Congress in Budapest pptx

Báo cáo khoa học: Diversity of human U2AF splicing factors Based on the EMBO Lecture delivered on 7 July 2005 at the 30th FEBS Congress in Budapest pptx

... information on the diversity of U2AF pro- teins and we discuss the resulting implications for splicing regulation. Structural features of U2AF and U2AF- related proteins The U2AF 65 protein contains ... alignment. U2AF diversity I. Mollet et al. 4810 FEBS Journal 273 (2006) 48 074 816 ê 2006 The Authors Journal compilation ê 2006 FEBS THE EMBO LECTURE D...

Ngày tải lên: 23/03/2014, 10:20

10 410 0
An Investigation of English Listening Strategies Used by Thai Undergraduate Students in Public Universities in the South pdf

An Investigation of English Listening Strategies Used by Thai Undergraduate Students in Public Universities in the South pdf

... X 12 วารสารศิลปศาสตร์  An Investigation of English Listening Strategies Used by Thai Undergraduate Students in Public Universities in the South Thitipat Watthajarukiat 1 Monta Chatupote 2 Panida Sukseemuang 3 ... time, using the skills of listening and speaking. Oral communication directly involves both...

Ngày tải lên: 02/04/2014, 05:20

17 947 5
Summary of PHD thesis in economics labor structure transfer by industries in thai binh at the present

Summary of PHD thesis in economics labor structure transfer by industries in thai binh at the present

... Situation of labor structure transfer by industries and in industry in Thai Binh in terms of scale 3.2.1.1. Changes in labor ratio by economic industries in Thai Binh In 2005, Thai Binh had 945,9 laborers, ... by industries in the province. - To evaluate the labor structure transfer by industries in Thai Binh and causes of...

Ngày tải lên: 14/07/2014, 13:33

27 356 0
Báo cáo lâm nghiệp: "Variation of the tree form factor and taper in European larch of Polish provenances tested under conditions of the Beskid Sądecki mountain range (southern Poland)" docx

Báo cáo lâm nghiệp: "Variation of the tree form factor and taper in European larch of Polish provenances tested under conditions of the Beskid Sądecki mountain range (southern Poland)" docx

... University of Cracow. Variation of the tree form factor and taper in European larch of Polish provenances tested under conditions of the Beskid Sądecki mountain range (southern Poland) J. S 1 , ... estimation of variation of the tree form factor for all data within individual provenances was done in several stages. Since...

Ngày tải lên: 07/08/2014, 10:22

10 374 0
Báo cáo khoa học: "Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - implications for the synchrony with the phenology of the twisting rust fungus" potx

Báo cáo khoa học: "Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - implications for the synchrony with the phenology of the twisting rust fungus" potx

... complete the early stages of growth. Other prove- Original article Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - ... before or at the very beginning of maritime pine shoot sus- ceptibility (unpublished results). This may explain the very irregular pattern...

Ngày tải lên: 08/08/2014, 19:21

16 417 0
Báo cáo y học: " Gene therapy in animal models of rheumatoid arthritis: are we ready for the patients" pdf

Báo cáo y học: " Gene therapy in animal models of rheumatoid arthritis: are we ready for the patients" pdf

... meet the variable demands imposed by the intermittent course of RA. Evidence from animal models convincingly supports the application of gene therapy in RA, and the feasibility of gene therapy was ... synovial lining layer in both arthritis models. An alternative approach for suicide gene therapy is to inhibit cell proliferation. The cell cycle is contro...

Ngày tải lên: 09/08/2014, 01:24

14 578 0
Báo cáo y học: "Correspondence in relation to the case report "Capnography as an aid in localizing the phrenic nerve in brachial plexus surgery. Technical note." published in May issue of Journal of Brachial Plexus and Peripheral Nerve Injury" potx

Báo cáo y học: "Correspondence in relation to the case report "Capnography as an aid in localizing the phrenic nerve in brachial plexus surgery. Technical note." published in May issue of Journal of Brachial Plexus and Peripheral Nerve Injury" potx

... "Capnography as an aid in localizing the phrenic nerve in brachial plexus surgery. Technical note." published in May issue of Journal of Brachial Plexus and Peripheral Nerve Injury Pradipta ... Nor they mentioned anything about intraoperative ventilatory technique during maintenance of anesthesia. From the pattern of the capn...

Ngày tải lên: 10/08/2014, 10:20

2 428 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" potx

Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" potx

... release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells Aruna Kode, Se-Ran Yang and Irfan Rahman* Address: Department of Environmental Medicine, ... Central Page 1 of 3 (page number not for citation purposes) Respiratory Research Open Access Correction Differential effects of cigarette smoke on...

Ngày tải lên: 12/08/2014, 15:21

3 307 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" pps

Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" pps

... Research Open Access Research Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar ... in primary human small air-way epithelial cellsFigure 1 Cigarette smoke extract differentially caused cytotoxicity in...

Ngày tải lên: 12/08/2014, 16:20

20 478 0
Báo cáo y học: "Risk stratification of early admission to the intensive care unit of patients with no major criteria of severe community-acquired pneumonia: development of an international prediction rule" potx

Báo cáo y học: "Risk stratification of early admission to the intensive care unit of patients with no major criteria of severe community-acquired pneumonia: development of an international prediction rule" potx

... of early admission to the intensive care unit of patients with no major criteria of severe community-acquired pneumonia: development of an international prediction rule Bertrand Renaud 1 , José ... properly cited. Abstract Introduction To identify risk factors for early (< three days) intensive care unit (ICU) admission of patien...

Ngày tải lên: 13/08/2014, 16:20

11 471 0
Measures to promote the reform of administrative procedures in the operation of the public universities in vietnam (Sum)

Measures to promote the reform of administrative procedures in the operation of the public universities in vietnam (Sum)

... recently then offer measures to improve the reform of administrative procedures in operation of the public universities in Vietnam at present in serving for the mission of the reform of university ... Contents of the reform of administrative procedures: For Ministry of Education and Training, according to plan of administrative pro...

Ngày tải lên: 22/10/2014, 11:11

29 290 0
w