Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?

Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?

Blood on FTA™ Paper: Does Punch Location Affect the Quality of a Forensic DNA Profile?

... occurred at the edge punch location (25%, Table 2). Out of all the reactions at each punch location, 4% of the center punch and edge punch location reactions failed and 8% of the halfway punch location ... minutes, and snap cooled at 4° C. The 28 punch location and 21% at the edge punch location. Out of all the successful reactions at each pu...
Ngày tải lên : 24/08/2014, 12:30
  • 169
  • 383
  • 0
Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

... GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG 429 RT-PCR CaN AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT 205 RT-PCR CaMKII CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT 530 ... a more robust Ca 2+ uptake by these mitochondria, as the uniporter can transport Ca 2+ ions, as long as the mitochondrial membrane potential is maintained. Nonetheless, the additional mitoc...
Ngày tải lên : 19/02/2014, 07:20
  • 13
  • 578
  • 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc

Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc

... obtain a reliable retrieval of the imaginary part of ℑµ for ±10% discordance of any of the other mechanical descriptors or of x 1 . On the other hand, it was shown that a ±10% discordance of the ... field practice, to collect and process data at multiple receiver locations on the ground. A necessary generalization of this investigation is the retrieval of...
Ngày tải lên : 18/03/2014, 01:21
  • 26
  • 467
  • 0
Báo cáo khoa học: Reducing expression of NAD+ synthesizing enzyme NMNAT1 does not affect the rate of Wallerian degeneration ppt

Báo cáo khoa học: Reducing expression of NAD+ synthesizing enzyme NMNAT1 does not affect the rate of Wallerian degeneration ppt

... (NotI and BamHI site underlined and italics) 5¢-AGGAAAAAA GCGGCCGCACACTTACAGCCTGAG GCG-3¢,5¢-CGC GGATCCACTCCAAGGATACACTCC GA-3¢;3¢ homology arm (HindIII site underlined and ital- ics) 5¢-GGCCC AAGCTTATATATTTGCCTAGGAGGGT NMNAT1 ... FEBS C-3¢,5¢-GGCCCAAGCTTAAGACAGTGTGGAGGAGA CCT-3¢. The targeted region (SalI site underlined and ital- ics) was 5¢-CAACGC GTCGACCCATGTGCTGAAAGCT TGGT-3¢,5¢-ACTGGC...
Ngày tải lên : 22/03/2014, 16:20
  • 14
  • 401
  • 0
báo cáo hóa học:" Does self-regulation and autonomic regulation have an influence on survival in breast and colon carcinoma patients? results of a prospective outcome study" potx

báo cáo hóa học:" Does self-regulation and autonomic regulation have an influence on survival in breast and colon carcinoma patients? results of a prospective outcome study" potx

... than classical HRQL. The aim of this study was to assess the association of autonomic regulation (aR) and self-regulation (SR) with survival. Methods: 146 cancer patients and 120 healthy controls ... patients participating in the study had a mean dise ase duration of 1.7 years, 23 (45.1%) of them a disease duration of less than 1 year, 13 (25.5%) in the last month. Only...
Ngày tải lên : 20/06/2014, 15:20
  • 11
  • 538
  • 0
Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx

Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx

... crosses average trajectory), mean angular displacement (MAD: time-average of absolute values of the instantaneous turning angle of the sperm head along its curvilinear trajectory), lateral head displacement ... life stages. There has been considerable debate over the possible risk and/or benefits of isoflavone consumption during the sensitive stages of fetal and infant devel...
Ngày tải lên : 07/08/2014, 18:20
  • 8
  • 343
  • 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx

Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx

... equivalents. Statistical analysis Data were analysed with the following nonparametric sta- tistical methods: Mann–Whitney (unpaired data) and Wil- coxon (paired data) tests for comparison of groups, and Spearman's ... has a strong antagonistic activity and neutralises the effects of VEGF; it plays a pivotal role in the generation of vascular diseases such as pre-eclampsia...
Ngày tải lên : 09/08/2014, 01:23
  • 6
  • 518
  • 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

... has revealed that restricted an- timicrobials has been started to be utilized more ra- tionale after the initiation of NARP. Also carbapenem resistance rates of Pseudomonas spp and Acinetobacter ... years before and after of the initiation of NARP in 2003. The study in- cluded the data obtained from all of the four univer- sity hospitals, and one referral tertiary-care e...
Ngày tải lên : 25/10/2012, 11:00
  • 6
  • 692
  • 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater

... ascends to the top of the tank. It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall. Part of this ... function of the density, specific heat capacity and the initial and mass- weighted average temperatures of water; with all the values, apart from the mass-wei...
Ngày tải lên : 05/09/2013, 15:28
  • 12
  • 520
  • 1
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

... fact that these indicators are much easier to measure. In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that ... sophisticated information systems and data warehouses been able to manage a great deal of data. The challenge is to capture and measure soft and qualitative information. For example,...
Ngày tải lên : 20/12/2013, 17:15
  • 15
  • 796
  • 0

Xem thêm