Báo cáo y học: "Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery" potx
Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx
...
‡
United States Department of Agriculture, Agricultural Research
Service, Animal and Natural Resources Institute, Animal Parasitic Diseases Laboratory, Baltimore Avenue, Beltsville, MD 20705, USA.
§
Department ... analysis of eight Toxoplasma gondii isolates from Uganda has revealed chromosome sorting and local allelic vari-ants.</p>
Abstract
Background: Toxoplasma gondii is...
Báo cáo y học: "Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery" potx
... 2.
After SNP calling by MAQ, we applied additional filters. We
required each putative SNP to have a median quality value of
the variant base of at least 20 and that at least 20% of the
reads ... strand
and have a lower than average base quality at the variant posi-
tion. We required for a SNP call that the average base quality
is ≥20 and that at least 20% of the reads are from...
Báo cáo y học: "Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutation" pptx
... Translation g28 3a GAA->AAA E95K
LactD rph-pyrE RNase PH/orotate
phosphoribosyltransferase
Metabolic Δ82 bp Frameshift
ppsA Phosphoenolpyruvate synthase Metabolic c28 8a ATC->ATA I96I
atoS ... translational stop)
(Δ82 translational stop)
Δ82
GAGCCGTTCACCCATGAAGAGCTACTCATCTTGTTGGCTCTGGCCCGAGGGGCAGAAGGC
610-
670 -
GAATCGAATCCATTGTAGCGAC GCAGAAGGC GGCGCTGGCAAA
... other
interpretations...
Báo cáo y học: "Whole-genome analysis of mRNA decay in Plasmodium falciparum reveals a global lengthening of mRNA half-life during the intra-erythrocytic development cycle" pptx
... and images analyzed using Axon GenePix software
(Molecular Devices, Union City, CA, USA). Microarray data
were stored using NOMAD database software [32]. All micro-
array data are available at ... half-life for each
Comparison of decay rate calculated by microarray and by Northern blotFigure 5
Comparison of decay rate calculated by microarray and by Northern blot.
The half-lives for...
Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps
... broad range of uncultivatable organisms
from which only a handful of contaminant-free DNA can be
extracted.
Finally, an important goal of the present study was to gather
a large amount of genome ... abortus
0.2
Nosema ceranae
Nosema ceranae
Nosema ceranae
Nosema ceranae
Antonospora locustae
Antonospora locustae
Antonospora locustae
Octosporea bayeri
Enterocytozoon biene...
Báo cáo y học: "The genome sequence of Podospora anserina, a classic model fungus" pps
... ffuummiiggaattuuss
aanndd
AA oorryyzzaaee
Nature
2005,
443388::
1105-1115.
7. Fedorova ND, Khaldi N, Joardar VS, Maiti R, Amedeo P, Anderson
MJ, Crabtree J, Silva JC, Badger JH, Albarraq A, Angiuoli ... S, Doonan JH, Yu J, Vienken K, Pain A, Freitag
M,
et al.
:
SSeeqquueenncciinngg ooff
AAssppeerrggiilllluuss nniidduullaannss
aanndd ccoommppaarraattiivvee aannaallyyssiiss
wwiitthh...
Báo cáo y học: " Whole genome transcriptome polymorphisms in Arabidopsis thaliana" ppt
... splicing variation and transcribed fragment variation.Click here for fileAdditional data file 5R codes for annotation-based analysisR codes for annotation-based analysis.Click here for fileAdditional ... samples to the Arabidopsis tiling array 1.0 F (Affyme-
trix, Santa Clara, California, USA). Four maternal seed batch
replicates (Materials and methods) were included for each of
t...
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... were
residues Gly261 and Gly262. The replacement of Gly262 by
Ala resulted in an inactive enzyme. Substitution of Gly261
by Ala resulted to an enzyme with lower stability and
increased energy of activation. ... aromatic ring of Tyr269, and these
unfavorable interactions could lead to a decrease of local
flexibility and an increased E
a
value.
The validity of the above interpret...
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... 2002
RESULTS
Isolation of a 2Cys-Prx by using a single cysteine
mutant of
Chlamydomonas
Trx h
In an attempt to isolate new T rx targets in Chlamydomonas,
a s trategy w as used based o n the formation o f stable ... functional characteristics of Ch-PRX1
The amino-acid sequence of Ch-Prx1 shares highest identity
with the BAS1 protein of Brassica, spinach, barley and
A. thalia...
Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx
... activity. This
interaction potentially allows a crosstalk between cAMP
pathways and ras-mediated pathways in cell cycle control.
In addition to its many roles as an intracellular messenger,
cAMP also ... subunit of trypanosomal PKA. The
coprecipitated kinase is recognized by an antibody
against the bovine PKA catalytic subunit, the enzyme
phosphorylates a PKA-specific substrate [32], and...