Báo cáo y học: "Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers" pdf

Báo cáo y học: "Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers" pdf

Báo cáo y học: "Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers" pdf

... grade Papillary thyroid carcinoma 1 CT Papillary thyroid carcinoma 1 TC Early stage HCC Myeloma CRCC 1 T−cell lymphoma Papillary thyroid carcinoma 1 FV UBC 1 Lung adenocarcinoma Advanced HCC Colorectal adenoma Wilms ... 46% of all datasets and contains tumors from a diversity of anatomical locations, including lung carcinomas, bladder cancers, hepatocellular carcinomas and the hematolog...

Ngày tải lên: 14/08/2014, 20:22

19 298 0
Báo cáo y học: "Analysis of gene expression in operons of Streptomyces coelicolor" ppsx

Báo cáo y học: "Analysis of gene expression in operons of Streptomyces coelicolor" ppsx

... [http://www.ebi.ac.uk/arrayexpress/] 41. Parkinson H, Sarkans U, Shojatalab M, Abeygunawardena N, Contrino S, Coulson R, Farne A, Garcia Lara G, Holloway E, Kapushesky M, et al.: ArrayExpress -a public ... involving both internal transcriptional initiation and termination. Finally, to gain some insight into the complexity of intra- operonic gene regulation, intra-operonic genes were spl...

Ngày tải lên: 14/08/2014, 16:21

12 281 0
báo cáo khoa học: " Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance" pps

báo cáo khoa học: " Analysis of gene expression in response to water deficit of chickpea (Cicer arietinum L.) varieties differing in drought tolerance" pps

... 9210 scanner (Amersham Biosciences). Data analysis for DNA-array Data analysis was performed using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The radioactive intensity of each spot was quantified ... Ueda A, Shi W, Nakamura T, Takabe T: Analysis of salt-inducible genes in barley roots by differential display. J Plant Res 2002, 115(1118):119-130. 10. Rabbani MA, Maruyama K...

Ngày tải lên: 12/08/2014, 03:21

14 370 0
báo cáo khoa học: " Analysis of gene expression in cotton fiber initials" pptx

báo cáo khoa học: " Analysis of gene expression in cotton fiber initials" pptx

... (5'-3') Contig13 CGGTCGATATTGTTGCAATG AGGAGAAAGGCAGCAGCTAA Contig4289 GATGTCGAGGAGAACATTTGC TTGGTGCCAACAAAAATCAA Contig10804 TGGTACATGCGGTATCACAAA TCAAAGCACATTGACCACCT UCE CCATTCAAAGGCCTCCCCAAGGTTT ... CCATTCAAAGGCCTCCCCAAGGTTT CCACACCACCACTTTATCAAAGGATCCAA Contig1481 ACGATCAGGGTGTGGAGAAG GTGAGATGACCCCCTGAAAA Contig17143 AAACCCCCAAAATGGCTAAC TCACAGTGCCATAGAGATGGA Contig6348 CTCGTCTC...

Ngày tải lên: 12/08/2014, 05:20

13 308 0
Báo cáo y học: "Modulation of gene expression in drug resistant Leishmania is associated with gene amplification, gene deletion and chromosome aneuploidy" ppsx

Báo cáo y học: "Modulation of gene expression in drug resistant Leishmania is associated with gene amplification, gene deletion and chromosome aneuploidy" ppsx

... statistical method and inter-array normalization was done by using the 'quantiles of A& apos; method for each array [89]. Statistical analysis was done using linear model fitting and standard errors ... Kothari H, Kumar P, Mandal G, Chatterjee M, Venkatachalam S, Govind MK, Mandal SK, Sundar S: Differential gene expression analysis in antimony-unresponsive Indian kala azar (visc...

Ngày tải lên: 14/08/2014, 20:22

16 300 0
Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx

Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx

... normal as an indicator for intravascular vol- ume loss and therefore as an initial marker of bleeding. Stewart and colleagues [4] recently analyzed BNP and transthoracic echocardiogram in trauma ... significantly correlate with a decreased CI as a parameter for cardiovascular function. The data of this pilot study may indicate a potential value of NT- proBNP in the diagnosis...

Ngày tải lên: 13/08/2014, 11:22

8 291 0
Báo cáo y học: "Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human" ppt

Báo cáo y học: "Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human" ppt

... 5'-CAAAGCCATCAGACAGCAGA-3', 5'-GAGAC- CAGGAAAGTCGAAGG-3'; CB552531: 5'-CTGGAATAAGGCCAGAAGCA-3', 5'-ATTCCT- CAGGTCTGGTGGAG-3'; CX078596: 5'-CCTCATGGTGTGGCTATGTG-3', ... 5'-CCTCCTTGGACTTGGACCTT-3', 5'- AGGACAGGAGTCTTGCCAAA-3'; CB555845: 5'-GTCAACAGGCTGGCATTTTA-3', 5'-CAAT- TATTGACCCCAAGGCTA-3'; CX078592: 5...

Ngày tải lên: 14/08/2014, 14:21

16 322 0
Báo cáo y học: "Analysis of adenovirus trans-complementationmediated gene expression controlled by melanoma-specific TETP promoter in vitro" ppsx

Báo cáo y học: "Analysis of adenovirus trans-complementationmediated gene expression controlled by melanoma-specific TETP promoter in vitro" ppsx

... Taki M, Nishizaki M, Kyo S, Nagai K, Urata Y, Tanaka N, Fujiwara T: Visualization of intrathoracically disseminated solid tumors in mice with optical imaging by telomerase- specific amplification ... In addition, as strong and specific deliv- ery of therapeutic genes is one of the main goals of can- cer therapy, it may be of importance for the general usage of the binary Ad...

Ngày tải lên: 12/08/2014, 04:20

17 410 0
Báo cáo y học: "Analysis of variation of amplitudes in cell cycle gene expression" potx

Báo cáo y học: "Analysis of variation of amplitudes in cell cycle gene expression" potx

... arrests, respectively. Measurements of the intensities of gene expression from microarray experiments are subject to two main sources of variation: (i) technical variability including bioassay prep- aration, dye-effect and hybridization ... feature of micro- array data is that gene expression is an average value over a cell population rather than in a single cell. In g...

Ngày tải lên: 13/08/2014, 23:20

8 245 0
Báo cáo y học: "Analysis of Fcγ receptor haplotypes in rheumatoid arthritis: FCGR3A remains a major susceptibility gene at this locus, with an additional contribution from FCGR3B" ppsx

Báo cáo y học: "Analysis of Fcγ receptor haplotypes in rheumatoid arthritis: FCGR3A remains a major susceptibility gene at this locus, with an additional contribution from FCGR3B" ppsx

... prepared in the laboratory of EAJ and RWO, who partic- ipated in the original design of the study. FP and MA gave invaluable advice during the retrieval of sequence data from the public databases and ... susceptibility One advantage of the HTR framework for analysis of haplo- types is that other factors can be included in the model. The analysis was repeated including the RA-a...

Ngày tải lên: 09/08/2014, 07:20

9 450 0
w