Báo cáo sinh học: "Mosaicism of 50,XX/51,XX in a Murrah buffalo Bubalus bubalis" ppt
Báo cáo sinh học: "Mosaicism of 50,XX/51,XX in a Murrah buffalo Bubalus bubalis" ppt
... Autosomal trisomy in Zebu cattle. Can Vet J (in press) Note Mosaicism of 50,XX/51,XX in a Murrah buffalo Bubalus bubalis BR Yadav S Kumar 1 OS Tomer CR Balakrishnan 1 National Institute ... chromosomal analysis based on the G and C band staining techniques of the buffalo (Bubalus bubalis). Jpn J Vet Res 28, 122-128 Mori M, Sasalci NI...
Ngày tải lên: 14/08/2014, 20:20
báo cáo sinh học:" Impact of an in-built monitoring system on family planning performance in rural Bangladesh" pdf
... Sirajuddin AKM, Ashraf A: Impact of manage- ment training on family planning and health services per- formance in rural Bangladeh. J Int HRD 2000, 4:194-202. 13. Incorporation of community's ... Hasan Y, Ashraf A, Islam M, Rahman MM, Rahman M, Kane TT, Bar- kat-e-Khuda : Improving management support services. In Improving the Bangladesh health and family planning program: lesso...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Discovery of herpesviruses in multi-infected primates using locked nucleic acids (LNA) and a bigenic PCR approach" pdf
... TGTGGCTTCTCATGCTTvCA[n/i]TT[n/i]TG 560 3730as GTTGAGGCTCCG[n/i]TCsAC[n/i]CC 3731s 2 CTATCTCGAGCATCG[n/i]TTyCAyAAC 350 3731as AAAAGTACCCAATCTG[n/i]CCrAAsTG # I = Inosine $ approximate values Virology ... 460 2755as GATGTTCTGCGCCTGRWARTTRTAYTC CM-gB 2743s 1 CGCAAATCGCAGA(N/I)KC(N/I)TGGTG 330 2746as TGGTTGCCCAACAG(N/I)ATYTCRTT 2744s 2 TTCAAGGAACTCAGYAARAT(N/I)AAYCC 250 2745as CGTTGTCCTC(N/I)CC...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Impact of changes in diet on the availability of land, energy demand and greenhouse gas emissions of agriculture" pot
... data are based on the authors' calculation. Table 1. Area available for renewable energy feedstock production in Austria currently Arable land and grassland available for renewable ... A distinction was made between ruminant animals and monogastric animals. This calculation yielded the area of arable land and grassland needed for animal feed production [47]. The start...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Encapsulation of docetaxel in oily core polyester nanocapsule intended for breast cancer therapy" pptx
... USA). The bag containing the NCs' suspension was placed in 40 ml of PBS. The system was placed in a shaking water bath (BS-06, Lab. Companion, Des Plaines, IL, USA) at 37°C with an agitation ... formulation based on the size of the obtained blank NCs. An amount of 200 mg of polyesters was solubilized in an organic phase containing 10 ml of water-saturated ethyl acet...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" pptx
... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCAT- GGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACA- GAGTC-3'), ... protease, and an ubiq- uitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has bee...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: "volution of virulence in malaria" pps
... tthhaatt mmaayy e exxppllaaiinn pprrootteeccttiioonn aaggaaiinnsstt ffaallcciippaarruumm mmaallaarriiaa iinn ssiicckkllee ttrraaiitt aanndd bbeettaa tthhaallaasssseemmiiaa ttrraaiitt Blood 2004, 110044:: 3364-3371. 6. ... pprrootteeccttiioonn aagga aiinnsstt sseevveerree mmaallaarriiaall aannaaeemmiiaa PLoS Med 2008, 55:: e56. 8. Kwiatkowski DP: HHooww mmaallaarriiaa hhaass aaffffeecctte...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo sinh học: "Regulation of metabolism in Caenorhabditis elegans longevity" ppsx
... branched-chain amino acids isoleucine, leucine and valine, together with phenylalanine and tyrosine. A similar increase in branched-chain amino acids has been found in animals carrying mutations ... in daf-2/IGF1R, daf-28/insulin and ife-2/eIFE4 cause an increase in amino acid levels, especially branched-chain amino acids. Falk et al. [9] showed that mutations a ecting complexe...
Ngày tải lên: 06/08/2014, 19:21
Báo cáo sinh học: "Inheritance of fertility in broiler chickens" pdf
... what are basically binary data, alternative analyses to cater for the heterogeneity in variance can be undertaken. For example a threshold model has been fit- ted in Bayesian analyses to data ... traits within specialized male and female pure lines. To produce a commercial broiler, the aim is to enhance male fertility in a male line and female fertility in a female line with a...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Heritability of longevity in Large White and Landrace sows using continuous time and grouped data models" ppsx
... if both weaning date and number of weaned piglets were missing, culling date was set one day after the last farrow- ing. The choice of setting the culling date at 28 days after the last farrowing for ... with incomplete weaning date was based on the average nursing period in the whole dataset. Two intervals per parity were used for the grouped data model: from farrowing to weaning and f...
Ngày tải lên: 14/08/2014, 13:21