Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

... Central Page 1 of 7 (page number not for citation purposes) Genetic Vaccines and Therapy Open Access Research Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising ... into mature DCs. Due to in vitro RNA transcription, this method allows small tumors to be used for DC vaccine preparation; it is therefore a promising appro...

Ngày tải lên: 14/08/2014, 19:22

... Yuan Fang and Fansheng Kong Abstract Objective: To evaluate the efficacy of enhanced, intensive, immuno-suppressive therapy with umbilical cord blood support for severe aplastic anemi a (SAA). Methods: ... Enhanced, intensive, immuno-suppressive therapy with umbilical cord blood support may be an effective option for SAA therapy. To the Editor: Severe aplastic anemia (SAA) has a...

Ngày tải lên: 10/08/2014, 21:23

... Journal of Organisational Behavior 1997, 18:731-744. 188. Pritchard RD, Karasek BW: The effects of organisational cli- mate on managerial job performance and satisfaction. Organ- isational Behavior ... perform- ance of hospital ICUs. The authors found that the availa- bility of state -of -the- art technology was a statistically significant determinant of risk-adjusted pati...

Ngày tải lên: 18/06/2014, 17:20

... local approaches, all of the training local patches are not necessarily in the same class, and their eigenspace tends not to be obtained accurately. In addition, Kanemura et al. proposed a framework ... class such as face images and fingerprint images. However, since the global approach requires the assumption that all of the training images are in the same class, it is diffi...

Ngày tải lên: 18/06/2014, 22:20

... International Publisher. All rights reserved Research Paper A 12 Week, Open Label, Phase I/IIa Study Using Apatone ® for the Treatment of Prostate Cancer Patients Who Have Failed Standard Therapy ... administration in the treatment of prostate cancer in patients who failed standard therapy. Materials and Methods: Seventeen patients with 2 successive rises in PSA after...

Ngày tải lên: 08/08/2014, 17:20

... reducing the tumor size and facilitating surgical resection. Conclusion: A well-planned multidisciplinary approach should be part of the standard management of advanced or metastatic GIST. Background Gastrointestinal ... hospitalization. The postoperative course was complicated by the formation of a subhepatic abscess that was successfully treated with drainage cathe- te...

Ngày tải lên: 09/08/2014, 07:21

... performed using the MAS- COT MS/MS data search [35]. Searches were performed against databases and search parameters as mentioned above with the additional parameter of MS/MS mass tol- erance at ... virological investigations and supervision for the usage of the BSL-3 facility. All authors have read and approved the final manuscript. Acknowledgements We thank the Malaysian...

Ngày tải lên: 18/06/2014, 18:20

... reverse GGTTGTAGACAAGTTCTCCAAAAC B2M forward CTCCACAGGTAGCTCTAGGAG B2M reverse TCTGACCAAGATGTTGATGTTGG Nabzdyk et al. Journal of Translational Medicine 2011, 9 :48 http://www.translational-medicine.com/content/9/1/48 Page ... stromal cells such as AoSMCs are difficult to transfe ct and anal yze using flow cytometry. Therefore it is desirable to establish an assay that allows for a hig...

Ngày tải lên: 18/06/2014, 19:20

... data analysis as well as writing manuscript JH: making study plan and advising data analysis as well as writing manuscript All authors read and approved the final manuscript Acknowledgements The ... Zhongshan Hospital, Shanghai, China Full list of author information is available at the end of the article Wang et al. Journal of Translational Medicine 2011, 9:61 http://www.transla...

Ngày tải lên: 18/06/2014, 19:20

... statistical analysis, analyzed the data, and contributed to the writing of the article. PB put together the data, supervised the laboratory examinations, analyzed the data, and contributed to the ... the writing of the article. JFM analyzed the data, participated in the laboratory examina- tions, contributed to the editing of the article, and supervised the r...

Ngày tải lên: 09/08/2014, 06:23