Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

... six Identification of plasmid DNA rescuedFigure 2 Identification of plasmid DNA rescued. Nature of plasmid DNA obtained after transformation of cellular DNA from tissues of mice 2 days after i.m. immunization ... Access Research Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramu...

Ngày tải lên: 14/08/2014, 19:22

10 243 0
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

... from the concatenation of our r sequences. The main advantage of this method is that we can rely on a wide range of classical techniques to compute the exact or approxi- mated distribution of N’ ... of N’ (Poisson approximation or large deviations for example). The drawback of this approach is that N and N’ are clearly two different random variables and that deri...

Ngày tải lên: 12/08/2014, 17:20

18 409 0
Báo cáo sinh học: "Tissue distribution of DNA-Hsp65/TDM-loaded PLGA microspheres and uptake by phagocytic cells" docx

Báo cáo sinh học: "Tissue distribution of DNA-Hsp65/TDM-loaded PLGA microspheres and uptake by phagocytic cells" docx

... used for FACS analysis. FACS analysis To asses the biodistribution of the microspheres, an aliq- uot of 1 × 10 6 cells/tissue from the total cell preparation of the each tissue types was washed three ... after intramuscular administration For FACS analysis, gates (forward and size scatter) were set to eliminate non-ingested particles from the analyzed population. Flow cytome...

Ngày tải lên: 14/08/2014, 19:22

8 296 0
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt

báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt

... was used as an exploratory data analysis technique to reveal natural grouping from latent patterns in a large data set on the basis of a minimal within-group and a maximal between-group variation, ... the causes of professional dissatisf action. These questions need to be studied at greater depth and may result in the formula- tion of specific academic and professional pol...

Ngày tải lên: 18/06/2014, 17:20

9 305 0
Báo cáo khoa học: "Tissue distribution of bovine viral diarrhea virus antigens in persistently infected cattle Taekyun Shin* and Helen Acland1" ppt

Báo cáo khoa học: "Tissue distribution of bovine viral diarrhea virus antigens in persistently infected cattle Taekyun Shin* and Helen Acland1" ppt

... College of Agriculture, Cheju National University, Jeju 690-756, Korea 1 Pennsylvania Veterinary Laboratory, Harrisburg, PA 17110, USA The tissue distribution and cellular localization of viral antigens ... Greiser-Wilke, I. and Pohlenz, J. F. Organ and tissue distribution of the antigen of the cytopathogenic bovine virus diarrhea virus in the early and advanced phase of...

Ngày tải lên: 07/08/2014, 14:23

4 508 0
Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx

Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx

... of a particular age producing a live female calf, Mx); and reproductive value (relative contribution of an animal of a particular age to future generations, Vx). The overall ... Lauvergne et al, 1973; Martin, 1975; Basu and Ghai, 1980) and as a check on management practices (Nadkarni et al, 1983). A similar analysis was used by Ahm...

Ngày tải lên: 09/08/2014, 18:21

14 314 0
Báo cáo sinh học: "Computing distribution of scale independent motifs in biological sequences" pot

Báo cáo sinh học: "Computing distribution of scale independent motifs in biological sequences" pot

... proposition [1] the mid coordinate, 1/2, is invariably used as the initial position. Because this position cannot be mapped back to a real sequence this at first appeared as a reasonable proposition ... length of the sequence so the average height is one unit – which is to say that the area of the density distribution is, as it should for a unit square base, uni...

Ngày tải lên: 12/08/2014, 17:20

11 338 0
Báo cáo sinh học: " Identification of a differentially expressed gene, ACL, between Meishan · Large White and Large White · " pps

Báo cáo sinh học: " Identification of a differentially expressed gene, ACL, between Meishan · Large White and Large White · " pps

... GATACGCGTCAGCCCGCCACATCTCAG AC374F GATACGCGCATAGCCCAGCCCATCTC AC216F GATACGGCGAATTGGGAGGAAGCC AC169F GATACGCAATCGCCGGGCGGCTCGC AC158F GATACGCGGCTCGCACGGTGTGCC ACR GTACTCGAGCTGCTCTCTACGAAAGGCC 628 Z Q. Ren et al. 2.5. ... TCCACCACCCTGTTGCTGTA RACLF TCTGGGAGGTGTCAACGAG 58 ACL RACLR GGTCTTGGCATAGTCATAGGT AC996F GCTACGCGTTCAGCACTATCAGATCGGG AC756F GCTACGCGTCCTTCCTAGCCCCACCT AC698F GCCACGCGTATCTAT...

Ngày tải lên: 14/08/2014, 13:21

13 272 0
Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pdf

Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pdf

... AA5 and AA6 populations appeared distinct from AA9 and AA10 populations and close to the PS breed. This was in agreement with the studbook rules: on the basis of pedigree data, AA5, AA6, AA9 and ... groups according to the proportion of foreign genes that can be found from genealogical analy- sis: AA6 and AA9 are considered as pure AA, whereas AA5 and AA10 can have ancestors fro...

Ngày tải lên: 14/08/2014, 13:21

12 338 0
Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pot

Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pot

... MER and POIT. Finally, since the discussion on breed conservation is based on the use of several other methods and parame- ters, the above new results do not change our recommen- dations on which ... 95:247-254. 3. Caballero A, Toro MA: Analysis of genetic diversity for the management of conserved subdivided populations. Conserv Genet 2002, 3:289-299. Genetics Selection...

Ngày tải lên: 14/08/2014, 13:21

3 202 0
w