Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx
Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx
... sixIdentification of plasmid DNA rescuedFigure 2Identification of plasmid DNA rescued. Nature of plasmid DNA obtained after transformation of cellular DNA from tissues of mice 2 days after i.m. immunization ... AccessResearchTissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular deliveryAAM Coelho-Castelo1,2, AP Trombone1,2, RS Rosada1,2, ... vectors,enabling the use of lower doses and thereby reducing the risks in the clinical application of DNA vaccines. Nowa-days, one of the alternatives to reduce the amount of the plasmid administered...
- 10
- 243
- 0
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf
... from the concatenation of our r sequences. The main advantage of this method is that we can rely on a wide range of classical techniques to compute the exact or approxi-mated distribution of N’ ... of N’ (Poisson approximation orlarge deviations for example). The drawback of this approach is that N and N’ areclearly two different random variables and that deriving the P-value of an observed ... harmless since the marginal distribution of any non-stationary model converges very quicklytowards its stationary distribution. As long as the timeto convergence is negligible in comparison...
- 18
- 409
- 0
Báo cáo sinh học: "Tissue distribution of DNA-Hsp65/TDM-loaded PLGA microspheres and uptake by phagocytic cells" docx
... usedfor FACS analysis.FACS analysisTo asses the biodistribution of the microspheres, an aliq-uot of 1 × 106cells/tissue from the total cell preparation of the each tissue types was washed three ... after intramuscular administrationFor FACS analysis, gates (forward and size scatter) were setto eliminate non-ingested particles from the analyzedpopulation. Flow cytometric analysis of the ... Ana Paula Masson, Ms. Ana Flávia Gembre, Ms. Patrícia V.P. Palma, Maria Tereza P. Maglia and Ms. Márcia S.Z. Graeff for excellent technical assistance during the course of the studies. This...
- 8
- 296
- 0
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt
... wasused as an exploratory data analysis technique to revealnatural grouping from latent patterns in a large data set on the basis of a minimal within-group and a maximalbetween-group variation, ... the causes of professional dissatisf action. These questions need to bestudied at greater depth and may result in the formula-tion of specific academic and professional policies at the local ... adjustments were applied to control the false-positive error r ate. An alternative importancemeasure, which has the advantage of placing both types of variables on the same scale, is based on...
- 9
- 305
- 0
Báo cáo khoa học: "Tissue distribution of bovine viral diarrhea virus antigens in persistently infected cattle Taekyun Shin* and Helen Acland1" ppt
... College of Agriculture, Cheju National University,Jeju 690-756, Korea1Pennsylvania Veterinary Laboratory, Harrisburg, PA 17110, USA The tissue distribution and cellular localization of viralantigens ... Greiser-Wilke, I. and Pohlenz, J.F. Organ and tissue distribution of the antigen of the cytopathogenic bovine virus diarrhea virus in the early andadvanced phase of experimental mucosal disease. ... infections. The aim of the present study was to investigate the distribution pattern of viral antigens in three fulminating natural cases of BVDVinfection.Materials and MethodsCase historyTwo...
- 4
- 508
- 0
Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx
... of a particular age producing a live femalecalf, Mx); and reproductive value (relative contribution of an animal of a particularage to future generations, Vx). The overall ... Lauvergne et al, 1973; Martin, 1975; Basu andGhai, 1980) and as a check on management practices (Nadkarni et al, 1983). A similar analysis was used by Ahmad et al ... from the University of Alberta ranch at Kinsella,located 150 km south-east of Edmonton, Alberta, Canada. Two main breedingpopulations were established in 1960, namely the...
- 14
- 314
- 0
Báo cáo sinh học: "Computing distribution of scale independent motifs in biological sequences" pot
... proposition [1] the mid coordinate,1/2, is invariably used as the initial position. Because thisposition cannot be mapped back to a real sequence this atfirst appeared as a reasonable proposition ... length of the sequence so the average height is one unit – which is to say that the area of the density distribution is, as it should for a unit square base, unitary by definition. The three tables ... Markov chains. Annals of Statistics 1999, 27:480-513.21. Gutierrez JM, Rodriguez MA, Abramson G: Multifractal analysis of DNA sequences using a novel chaos-game representation.Physica A: Statistical...
- 11
- 338
- 0
Báo cáo sinh học: " Identification of a differentially expressed gene, ACL, between Meishan · Large White and Large White · " pps
... GATACGCGTCAGCCCGCCACATCTCAGAC374F GATACGCGCATAGCCCAGCCCATCTCAC216F GATACGGCGAATTGGGAGGAAGCCAC169F GATACGCAATCGCCGGGCGGCTCGCAC158F GATACGCGGCTCGCACGGTGTGCCACR GTACTCGAGCTGCTCTCTACGAAAGGCC628 Z Q. Ren et al.2.5. ... TCCACCACCCTGTTGCTGTARACLF TCTGGGAGGTGTCAACGAG 58 ACLRACLR GGTCTTGGCATAGTCATAGGTAC996F GCTACGCGTTCAGCACTATCAGATCGGGAC756F GCTACGCGTCCTTCCTAGCCCCACCTAC698F GCCACGCGTATCTATTAGCCTCGTCCCACAC486F GATACGCGTCAGCCCGCCACATCTCAGAC374F ... GTNCGASWCANAWGTTR3 WGTGNAGWANCANAGAR4 NCAGCTWSCTNTSCTTACSE CTGCTCTCTACGAAAGGCCGTGCACSF CCCAACTCGCCGCCTACCTTCCACSG TCGCCGCCTACCTTCCGGAGCGCRGHF ACCACAAGTCCATGCCATCAC 58 GAPDHRHGR TCCACCACCCTGTTGCTGTARACLF...
- 13
- 272
- 0
Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pdf
... AA5 and AA6 populations appeared distinct fromAA9 and AA10 populations and close to the PS breed. Thiswas in agreement with the studbook rules: on the basis of pedigree data, AA5, AA6, AA9 and ... groups according to the proportion of foreign genes that can be found from genealogical analy-sis: AA6 and AA9 are considered as pure AA, whereas AA5and AA10 can have ancestors from another origin, ... collection. LC performed the preliminary analysis.GL carried out the computational analysis and prepared the manuscript. XR participated in the computationalanalysis and preparation of the manuscript....
- 12
- 338
- 0
Báo cáo sinh học: " Genetic diversity of a large set of horse breeds raised in France assessed by microsatellite polymorphism" pot
... MER and POIT.Finally, since the discussion on breed conservation is based on the use of several other methods and parame-ters, the above new results do not change our recommen-dations on which ... 95:247-254.3. Caballero A, Toro MA: Analysis of genetic diversity for the management of conserved subdivided populations. ConservGenet 2002, 3:289-299.Genetics Selection Evolution 2009, 41:31 ... extinctionAgregate diversity and cryopreservation potential(Ollivier and Foulley, 2005)Loss or gain of diversity when a breed is removed and contributions to optimal diversity(Caballero and...
- 3
- 202
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtthe pressure exerted by a liquid in a container is dependent on theart which is dependent on the assistance of malign spiritsbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ