Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx

... using primers VP22 F9 (5' ACTCTAGCTAGC ACGGCGCCAAC- CCGATCCAAGACA 3') and VP22 R8 (5' ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCT- GGACCCTCGACGGGCCGTCTGGGGCGAGA 3'). Addi- tionally, the gene ... kinase [3] or the BioMed Central Page 1 of 9 (page number not for citation purposes) Genetic Vaccines and Therapy Open Access Research Evaluation of the VP22 protein...

Ngày tải lên: 14/08/2014, 19:22

... surgery, radiotherapy, and chemotherapy has been the standard care for the treatment of breast, ovarian, and head and neck cancer. However, in the last decade, the approaches to cancer therapy have change ... 1998, the approval of trastuzumab for the treatment of breast cancer was a mile- stone which established a new class of cancer treatment that utilizes immune...

Ngày tải lên: 18/06/2014, 22:20

... tri- phosphate, and 0.25 mM aminoallyl-dUTP. For qRT- PCR,cDNAwaspreparedasabovewiththeexclusion of aminoallyl-dUTP. S. aureus DNA microarray hybridization and analysis Hybridization of synthesized cDNAs ... Statistical ana- lysis was performed using a Significance Analysis of Microarrays (SAM) [32] unpaired contrast, available through the TM4 software package (JCVI). A false...

Ngày tải lên: 12/08/2014, 17:20

... IntraHealth International's Learning for performance: a guide and toolkit for health worker training and education programs offers a step-by-step, customizable approach designed to develop the ... NC: IntraHealth International 3. IntraHealth: Performance-based learning: applying a new approach at a nursing school in Mali. Voices from the Capac- ity Project #5. 2007 [http:...

Ngày tải lên: 18/06/2014, 17:20

... FOXG_08602Method and analysis of transformants deleted for FOXG_08602.Click here for fileAdditional data file 8Method and analysis of transformants deleted for FOXG_03318Method and analysis of transformants ... entire transformant collection (a random subset of 72 out of the 10,290 transformants was analyzed in the same way; data not shown). In 22 of the mutants in wh...

Ngày tải lên: 14/08/2014, 21:20

... 'nef G 2A E 4A4 AxxA LLAA KKAA '12-39 ** + + p24 production (AUC) wt 'nef G 2A E 4A4 AxxA LLAA KKAA '12-39 wt 'nef G 2A E 4A4 AxxA LLAA KKAA '12-39 CD4 depletion (%) wt 'nef ... from these quadruplicates. For comparison of individual HLAC infections, mean values of each data set were averaged with the indicated standard error of the mean....

Ngày tải lên: 13/08/2014, 05:21

... ppaallaattee aanndd aabbnnoorrmmaalliittiieess ooff ccrraanniiooffaacciiaall aanndd ttooootthh ddeevveellooppmmeenntt Nat Genet 1994, 66:: 348-356. 7. van den Boogaard MJ, Dorland M, Beemer FA, ... causation involving multiple genetic and/or environmental factors. In cases with available parental samples, one parent has always been found to harbor the same variant, even when they are unaff...

Ngày tải lên: 06/08/2014, 19:20

... Klassen N, Kazanjian A, Apland L, Adalikwu J, Crush J, McIntosh T, Schrecker T, Walker J, Zakus D: The Brain Drain of Health Professionals from Sub-Saharan Africa to Canada. In African Migration ... Canada: Pan-Canadian Health Human Resource Strategy. 2007-2008 Annual Report. Ottawa 2008. 5. Labonté R, Packer C, Klassen N: Managing health professional migration from Sub-Saharan Africa to...

Ngày tải lên: 18/06/2014, 17:20

... direct information on the mecha- nism of action of HRSV neutralizing antibodies directed against the F protein such as ch101F. A thorough characterization of the epitopes on the F pro- tein for HRSV ... neutralizing mAbs may provide insights into the mechanisms of action by which mAbs against the HRSV F protein neutralize virus as well as a better under- stan...

Ngày tải lên: 18/06/2014, 18:20

... cyclophosphamide were administered on days - 1, +1, and +3 after viral inoculation. Statistical analysis Analysis of numerical data and statistical analyses were performed with the software packages ... purchased from Taconic Farms (Germantown, NY). These studies were reviewed and approved by an IACUC, and animals were handled in accordance with the NIH Guide for the Care and Use o...

Ngày tải lên: 19/06/2014, 08:20