Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx
Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx
... usingprimers VP22 F9 (5' ACTCTAGCTAGCACGGCGCCAAC-CCGATCCAAGACA 3') and VP22 R8 (5'ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCT-GGACCCTCGACGGGCCGTCTGGGGCGAGA 3'). Addi-tionally, the gene ... kinase [3] or the BioMed CentralPage 1 of 9(page number not for citation purposes)Genetic Vaccines and TherapyOpen AccessResearchEvaluation of the VP22 protein for enhancement of a DNA vaccine ... small animal models, their efficacy inlarger animal models and primates is insufficient. In thisstudy, we evaluate the potential of VP22 to enhance DNA vaccines against anthrax. The spore-forming...
- 9
- 331
- 0
Báo cáo sinh học: "Combination therapy: the next opportunity and challenge of medicine" ppt
... surgery,radiotherapy, and chemotherapy has been the standardcare for the treatment of breast, ovarian, and head andneck cancer. However, in the last decade, the approachesto cancer therapy have change ... 1998, the approval of trastuzumab for the treatment of breast cancer was a mile-stone which established a new class of cancer treatmentthat utilizes immune based mechanisms rather than cyto-toxic ... immu notherap y,2010 became a milestone year for the biological therapy of cancer. In 2010, the first anti-cancer vaccine received FDAapproval (Sepuleucel-T for the treatment of prostate can-cer)...
- 3
- 329
- 0
Báo cáo sinh học: "Alterations in the transcriptome and antibiotic susceptibility of Staphylococcus aureus grown in the presence of diclofenac" pps
... tri-phosphate, and 0.25 mM aminoallyl-dUTP. For qRT-PCR,cDNAwaspreparedasabovewiththeexclusion of aminoallyl-dUTP.S. aureus DNA microarray hybridization and analysisHybridization of synthesized cDNAs ... Statistical ana-lysis was performed using a Significance Analysis of Microarrays (SAM) [32] unpaired contrast, availablethrough the TM4 software package (JCVI). A false discov-ery rate of 0.05 and at ... Dupre2, Stephanie A Cantore-Matyi2, Atul Kumar-Singh3, Yang Song3,Shahrear Zaman2, Sonia Horan2, Nada S Helal1, Vijayaraj Nagarajan4,5, Mohamed O Elasri4, Brian J Wilkinson3andJohn...
- 11
- 363
- 0
báo cáo sinh học:" Focusing on the essentials: learning for performance Catherine J Murphy" pptx
... IntraHealth International's Learning for performance: a guide and toolkit for health worker training and education programs offers a step-by-step, customizableapproach designed to develop the ... NC: IntraHealth International3. IntraHealth: Performance-based learning: applying a newapproach at a nursing school in Mali. Voices from the Capac-ity Project #5. 2007 [http://www.capacityproject.org/images/stories/Voices/voices_5.pdf]. ... training in three countries: India, Mali andBangladesh. Based on IntraHealth's experiences, the author provides thoughts on how LFP'sperformance-based learning approach can be a useful...
- 4
- 346
- 0
Báo cáo y học: "Insight into the molecular requirements for pathogenicity of Fusarium oxysporum" pdf
... FOXG_08602Method and analysis of transformants deleted for FOXG_08602.Click here for fileAdditional data file 8Method and analysis of transformants deleted for FOXG_03318Method and analysis of transformants ... entire transformant collection (a random subset of 72 out of the 10,290 transformants was analyzed in the same way; data not shown). In 22 of the mutants in which a double T -DNA integration had occurred, ... characteristics of T -DNA integrationinto the genome of F. oxysporum and to facilitate selection of mutants for further analysis, all mutants were analyzed for T- DNA copy number, mode of T-DNA...
- 18
- 375
- 0
Báo cáo y học: "Determinants in HIV-1 Nef for enhancement of virus replication and depletion of CD4+ T lymphocytes in human lymphoid tissue ex vivo" doc
... 'nef G 2A E 4A4 AxxA LLAA KKAA '12-39**++p24 production (AUC)wt 'nef G 2A E 4A4 AxxA LLAAKKAA '12-39wt 'nef G 2A E 4A4 AxxA LLAA KKAA '12-39CD4 depletion (%)wt 'nef ... from these quadruplicates. For comparison of individual HLAC infections, mean values of each data setwere averaged with the indicated standard error of the mean. For evaluation of statistical ... tonsillectomy material. SH, OTK and OTF analyzed the data and OTF wrote the manuscript.Additional materialAcknowledgements The authors thank Dr. Lars Kaderali for expert advice on statistical evalua-tion...
- 14
- 264
- 0
Báo cáo sinh học: "Pitfalls in the phylogenomic evaluation of human disease-causing mutations" potx
... ppaallaattee aannddaabbnnoorrmmaalliittiieess ooff ccrraanniiooffaacciiaall aanndd ttooootthh ddeevveellooppmmeenntt Nat Genet1994,66::348-356.7. van den Boogaard MJ, Dorland M, Beemer FA, ... causationinvolving multiple genetic and/or environmental factors. Incases with available parental samples, one parent has alwaysbeen found to harbor the same variant, even when they areunaffected ... arrowheads).On the basis of the MSX phylogenomic analysis, Finnerty etal. [1] attempted to analyze the pathogenicity of each of these variants individually, as judged by the degree of sequence...
- 5
- 366
- 0
báo cáo sinh học:" Reflections on the ethics of recruiting foreigntrained human resources for health" pptx
... Klassen N, Kazanjian A, Apland L, Adalikwu J, Crush J,McIntosh T, Schrecker T, Walker J, Zakus D: The Brain Drain of HealthProfessionals from Sub-Saharan Africa to Canada. In African Migration ... Canada: Pan-Canadian Health Human Resource Strategy. 2007-2008Annual Report. Ottawa 2008.5. Labonté R, Packer C, Klassen N: Managing health professional migrationfrom Sub-Saharan Africa to Canada: ... (AMSSA): A Synopsis of Initiatives Affecting the Labour Market Integration of Foreign-Trained Professionals and Trades Workers. Vancouver 2000.41. Singh JA, Nkala B, Amuah E, Mehta N, Ahmad A: The...
- 11
- 703
- 0
Báo cáo sinh học: " Relationship between the loss of neutralizing antibody binding and fusion activity of the F protein of human respiratory syncytial virus" doc
... direct information on the mecha-nism of action of HRSV neutralizing antibodies directed against the F protein such as ch101F. A thorough characterization of the epitopes on the F pro-tein for HRSV ... neutralizing mAbs may provide insightsinto the mechanisms of action by which mAbs against the HRSV F protein neutralize virus as well as a better under-standing of the mechanism by which the F protein ... antibodies and F protein function, we used a recombinant approach to generate a panel of mutationsin antigenic sites II and IV/V/VI [18] of the F protein andcharacterized these mutations with...
- 4
- 271
- 0
Báo cáo sinh học: " Re-evaluating the role of natural killer cells in innate resistance to herpes simplex virus type 1" pot
... cyclophosphamide were administered on days -1, +1, and +3 after viral inoculation.Statistical analysisAnalysis of numerical data and statistical analyses wereperformed with the software packages ... purchased from Taconic Farms(Germantown, NY). These studies were reviewed andapproved by an IACUC, and animals were handled inaccordance with the NIH Guide for the Care and Use of Laboratory Animals. ... butactivated T cells also express ''NK cell'' markers [27].Therefore, the effect of anti-asialo GM1 and anti-NK1.1antibodies on host resistance to HSV-1 may be due, atleast...
- 15
- 344
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ