Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

... genes from three animal phyla is very unlikely to have arisen by chance, and suggests that a core set of developmental regulatory genes may be associated with CNEs across all animal lineages. Because ... this evolution of regulatory elements may underlie the astounding diversification of animal body plans that was seen during the Cambrian period approximately 5...

Ngày tải lên: 14/08/2014, 17:22

14 257 0
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... correspondence: Aer Lingus, Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian, bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines, Cyprus Airways, Czech Airlines, ... data analysis and inter- pretation of the data as well as the writing of the manuscript. FGB participated in the data analysis and interpretation of the study. DS particip...

Ngày tải lên: 25/10/2012, 10:31

6 640 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGAGTTTGGG-3¢. ... AppliChem (Darmstadt, Germany). All solvents and chemicals were of analytical grade and obtained fro...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

... technology/mechanisms Technology to support collaboration is available and placed rapidly in the hands of employees (KMAT)[103] Promoting external contacts We have a system that allows us to learn ... expressed in a way that could be inferred as an organisational characteristic (e.g., 'Our employees resist changing to new ways of doing things' [94]), and were excl...

Ngày tải lên: 11/08/2014, 05:21

15 386 0
Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

... Stimulatory and inhibitory sig- nals normally confine myofibroblasts to the period of pulmonary alveolarization and myofibroblasts are rarely observed in the adult lung [18]. Understanding more about ... tissues obtained from P4 and P12 animals that were stained concurrently. To avoid variabil- ity related to distances from the laser beam, alveolar entry rings located 1/4 to 1...

Ngày tải lên: 12/08/2014, 14:20

17 203 0
Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

... al[18] should have adjusted their analysis to assume that incom- plete efficacy is actually achieved in clinical practice. Talley et al's costs were measured accurately by applying correc- tion factors ... Intracoronary thrombolysis was used in 42% of patients later randomized to IABP therapy compared to 46% of patients in the standard therapy arm. Intravenous heparin was use...

Ngày tải lên: 12/08/2014, 18:20

6 575 0
Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx

Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx

... were ED12C (AGTGCTTCCTGCTGCTCCCA) and ED31C (CCATTACACAGGCCTGTCCAAAG) and the second round primers used were DR7C (TCAACTCAACTGGTC- CAAAG) and DR8C (CACTTCTCCAATTGTCCCTCA) that yield data on 694 ... our data using only the information gained from pol data strata and ignoring the env sequence data strata. In other cases, we form a subsample at random. For example, to simulate what we h...

Ngày tải lên: 12/08/2014, 23:21

12 331 0
Báo cáo y học: "Intensive care for the adult population in Ireland: a multicentre study of intensive care population demographics" pdf

Báo cáo y học: "Intensive care for the adult population in Ireland: a multicentre study of intensive care population demographics" pdf

... not participating in this dataset. A total of 72 traumatic brain inju- ries are described, of whom 32 were transferred to a neurosur- gical centre. There appeared to be a regional variation in transfer ... readmission rate to the ICUs was 7.5%, with a mortality of 23%. Analysis of the major dis- ease categories in the audit dataset revealed mortality rates of 32.3% for...

Ngày tải lên: 13/08/2014, 11:22

6 337 0
Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

... reduced ability to carry out daily tasks was merely a consequence of pain severity had to be reconsid- ered. Several studies have indicated that pain-related fear is one of the most potent predictors ... good for your health? Haworth Pastoral Press, Binghampton: NY; 1997. 39. Fayad F, Lefevre-Colau MM, Poiraudeau S, Fermanian J, Rannou F, Wlodyka Demaille S, Benyahya R, Revel M:...

Ngày tải lên: 13/08/2014, 13:22

5 355 0
Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx

Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx

... nasal discharg e and coughing) and rectal temperatures were recorded daily for 14 days post-inoculation (DPI), and nasal swab samples for the detection of viral shedding were also collected daily ... tudy, while 3 dogs lacked symptoms. All of the animals seroconverted a s assessed by a CIV competitive ELISA (data not shown). Clinical signs were observed from 4 to 8 DPI, and viral...

Ngày tải lên: 11/08/2014, 21:21

4 279 0
w