Báo cáo y học: "The Dictyostelium genome: the private life of a social model revealed" potx
... use as a model organism, the evolutionary distance between Dictyostelium and human is actually less than that between human and yeast, because the yeast lineage has experienced a higher rate of ... par- asite of mammals, causing diseases such as amoebic dysen- tery - an antisocial amoeba to Dictyostelium s social amoeba, perhaps. In keeping with its parasitic lifestyle, Ent...
Ngày tải lên: 14/08/2014, 14:21
... (RasGEFs) are the proteins that activate Ras and thus lie near the top of many signaling pathways. They are particularly important for signaling in development and chemotaxis in many organisms, ... of signaling domains sepa- rate from the RasGEF and RasGEF amino-terminal domain has been a central part of the identification of Ras signaling pathways in higher eukaryotes [33]....
Ngày tải lên: 14/08/2014, 14:21
... com- plements the validation provided by automated and manual analyses using the larger full-length cDNA dataset above. Although anecdotal rather than quantitative, the RT-PCR analysis at least indicates ... 5a- for, AATAAAAGTTGCAGTTATCTGTGCT; 5a- rev, ACGGCCGTATCATCATTTTG; 5b-for, CATGCTGTT- GGCCGTGTC; 5b-rev, CACGGTGGCCACAATGAT; 5c-for, GTGGTGTGCACTCCTCAAGA; 5c-rev, ATTCCGCGTTCGCACACT...
Ngày tải lên: 14/08/2014, 16:21
Báo cáo y học: "Schizophrenia pathophysiology: are we any closer to a complete model" pps
... schizophrenia operates more through a Dar- winian mechanism rather than a Mendelian mode of Annals of General Psychiatry 2009, 8:12 http://www.annals-general-psychiatry.com/content/8/1/12 Page 4 of 8 (page ... N-desmethylclozap- ine (NDMC) may play a role in mediating the efficacy of CLZ since it is metabolically active and capable of binding the sites of its parent comp...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Thymic large cell neuroendocrine carcinoma: report of a resected case - a case report" pptx
... (No.19-12). Author details 1 Department of Thoracic Surgery, Kitasato University School of Medicine, Kanagawa, Japan. 2 Department of Pathology, Kitasato University School of Medicine, Kanagawa, Japan. Authors’ ... curative treat- ment of thymic tumors. The differential diagnosis for the anterior mediastinum includes other primary mediastinal tumors, mainly thymoma, paragangliom...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Asymptomatic bronchial aspiration and prolonged retention of a capsule endoscope: a case report." potx
... remained in the bronchial system for six days without causing airway compromise Figure 1 Capsule endoscopy. Capsule endoscopy view of the bronchial system. Figure 2 X-ray of the chest. X-ray of the chest ... confirming the presence of the capsule in the left side of the bronchopulmonary tree. Figure 3 Second X-ray of the chest. Two days later, another X-ray of...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo y học: "Successful pregnancy outcome after laparoscopicassisted excision of a bizarre leiomyoma: a case report" pptx
... Int J Gynecol Pathol 2009, 28:529-534. 7. Yamashita Y, Torashima M, Takahashi M, Tanaka N, Katabuchi H, Miyazaki K, Ito M, Okamura H: Hyperintense uterine leiomyoma at T2-weighted MR imaging: ... the basis of their gross and microscopic appearances [3]), morphologic variants of leiomyoma are easily misinterpreted histologically as a malignancy [3,5,6]. Bizarre leiomyoma is one such r...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo y học: "Torsades de pointes during laparoscopic adrenalectomy of a pheochromocytoma: a case report" pdf
... tumors arising from the chromaffin cells of the adrenal medulla or extraadrenal paraganglia. A pheochromocytoma is a potential life- threatening dis- ease with a high risk of cardiovascular complications such ... inhabitants per year [1]. Traditionally, adrenalectomy for pheochromocytoma has been performed by open later al retroperitoneal sur- gery [2]. Nowadays, laparoscopic r...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot
... relapse is defined as a germ cell tumour that appears more than two years after therapy and complete remission [3]. Of the 81 patients treated at the University of Indiana for late relapse of ... showed late relapse more than five years after primary therapy and complete remission [3]. A series of 1263 patients with germ cell testicular tumour treated at the Department of...
Ngày tải lên: 11/08/2014, 14:20