Báo cáo y học: "The Dictyostelium genome: the private life of a social model revealed" potx
Báo cáo y học: "The Dictyostelium genome: the private life of a social model revealed" potx
... use as a model organism, the evolutionary distance between Dictyostelium and human isactually less than that between human and yeast, because the yeast lineage has experienced a higher rate of ... par-asite of mammals, causing diseases such as amoebic dysen-tery - an antisocial amoeba to Dictyostelium s social amoeba,perhaps. In keeping with its parasitic lifestyle, Entamoebahas some unusual ... species are highly adapted and extremelysuccessful, and can be found in almost any soil anywhere on the globe. They eat some organisms (mostly bacteria) and trynot to be eaten by others (such as...
- 4
- 314
- 0
Báo cáo y học: "he Dictyostelium genome encodes numerous RasGEFs with multiple biological roles" pdf
... (RasGEFs) are the proteins that activate Ras and thus lie near the top of many signaling pathways. They areparticularly important for signaling in development and chemotaxis in many organisms, ... of signaling domains sepa-rate from the RasGEF and RasGEF amino-terminal domainhas been a central part of the identification of Ras signalingpathways in higher eukaryotes [33]. However, half ... Dictyostelium. Two Ras proteins (RasG andRasD) are most similar to the canonical mammalian Rasfamilies, and others (RasB, RasC, the as-yet unpublishedRasX, and RasS) are less closely related...
- 12
- 167
- 0
Báo cáo y học: "Anopheles gambiae genome reannotation through synthesis of ab initio and comparative gene prediction algorithms" pps
... com-plements the validation provided by automated and manualanalyses using the larger full-length cDNA dataset above.Although anecdotal rather than quantitative, the RT-PCRanalysis at least indicates ... 5a- for, AATAAAAGTTGCAGTTATCTGTGCT; 5a- rev,ACGGCCGTATCATCATTTTG; 5b-for, CATGCTGTT-GGCCGTGTC; 5b-rev, CACGGTGGCCACAATGAT; 5c-for,GTGGTGTGCACTCCTCAAGA; 5c-rev,ATTCCGCGTTCGCACACT; 5d-for, TTACGCGCCGTAT-CACAAAT; ... TTACGCGCCGTAT-CACAAAT; 5d-rev, GTCTGTGATTGCCGAGCTG; 5e-for,AGATGAAGCTGCTTGCCAAT; 5e-rev, ATTGCCGTTGGTAC-GATCTC; 5f-for, AAACGTTTTGTTTGCGGTTT; 5f-rev,TCTCGCTCACACAAACATGC.Mass spectrometry and peptide...
- 12
- 275
- 0
Báo cáo y học: "Schizophrenia pathophysiology: are we any closer to a complete model" pps
... schizophrenia operates more through a Dar-winian mechanism rather than a Mendelian mode of Annals of General Psychiatry 2009, 8:12 http://www.annals-general-psychiatry.com/content/8/1/12Page 4 of 8(page ... N-desmethylclozap-ine (NDMC) may play a role in mediating the efficacy of CLZ since it is metabolically active and capable of binding the sites of its parent compound [40]. After clozapine,additional drugs ... during lateadolescence and early adulthood, because this is the period of increased myelination of the perforant pathway[6]. This pathway carries fibers from the entorhinal cortexto the hippocampus...
- 8
- 392
- 0
Báo cáo y học: "Thymic large cell neuroendocrine carcinoma: report of a resected case - a case report" pptx
... (No.19-12).Author details1Department of Thoracic Surgery, Kitasato University School of Medicine,Kanagawa, Japan.2Department of Pathology, Kitasato University School of Medicine, Kanagawa, Japan.Authors’ ... curative treat-ment of thymic tumors. The differential diagnosis for the anterior mediastinum includes other primary mediastinaltumors, mainly thymoma, paraganglioma, l ymphoma,parathyroid adenoma ... type. This lattercan often show areas displ aying a prominent neuroendo-crine appearance with abundant epithelial cells disposedradially around an empty space closely simulating the microacinar...
- 5
- 343
- 0
Báo cáo y học: "Asymptomatic bronchial aspiration and prolonged retention of a capsule endoscope: a case report." potx
... remained in the bronchialsystem for six days without causing airway compromiseFigure 1 Capsule endoscopy. Capsule endoscopy view of the bronchial system.Figure 2 X-ray of the chest. X-ray of the chest ... confirming the presence of the capsule in the left side of the bronchopulmonarytree.Figure 3 Second X-ray of the chest. Two days later, another X-ray of the chest was performed showing the capsule ... consent was obtained from the patientfor publication of this case report and any accompany-ing images. A copy of t he written consent is availablefor review by the Editor-in-Chief of this journal.AcknowledgementsWe...
- 3
- 277
- 0
Báo cáo y học: "Successful pregnancy outcome after laparoscopicassisted excision of a bizarre leiomyoma: a case report" pptx
... Int J Gynecol Pathol 2009,28:529-534.7. Yamashita Y, Torashima M, Takahashi M, Tanaka N, Katabuchi H, Miyazaki K,Ito M, Okamura H: Hyperintense uterine leiomyoma at T2-weighted MRimaging: ... the basis of their gross andmicroscopic appearances [3]), morphologic variants of leiomyoma are easily misinterpreted histologically as a malignancy [3,5,6].Bizarre leiomyoma is one such ra ... 5:344http://www.jmedicalcasereports.com/content/5/1/344Page 2 of 5JOURNAL OF MEDICALCASE REPORTSSuccessful pregnancy outcome after laparoscopic-assisted excision of a bizarre leiomyoma: a case reportTakeda et al.Takeda et al. Journal of Medical...
- 6
- 316
- 0
Báo cáo y học: "Torsades de pointes during laparoscopic adrenalectomy of a pheochromocytoma: a case report" pdf
... tumors arising from the chromaffin cells of the adrenal medulla or extraadrenal paraganglia. A pheochromocytoma is a potential life- threatening dis-ease with a high risk of cardiovascular complicationssuch ... inhabitants per year [1].Traditionally, adrenalectomy for pheochromocytomahas been performed by open later al retroperitoneal sur-gery [2]. Nowadays, laparoscopic removal of intraadrenaland ... presentation A 42-year-old Caucasian woman was referred to ouruniversity hospital because of a pheochromocytoma of the left adrenal gland. For one year, she had experiencedepisodic headaches, palpitations,...
- 5
- 290
- 0
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot
... relapse is defined as a germ cell tumour that appearsmore than two years after therapy and complete remission[3]. Of the 81 patients treated at the University of Indianafor late relapse of ... showed laterelapse more than five years after primary therapy andcomplete remission [3]. A series of 1263 patients with germ cell testicular tumourtreated at the Department of Radiotherapy and ... Oncologyin Surrey, United Kingdom showed that only 14 patientshad late relapse between the 5th and 10th year afterprimary treatment with a calculated annual risk of 1%. Intwo patients, late relapse...
- 4
- 294
- 0
Từ khóa: báo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenpouring the anatomic portion of a study modelbáo cáo giáo dục thể chất trường tiểu họcbáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hoctổ chức trình bày báo cáo trước tập thể lớp và gv cũng như các thắc mắc khi thực hiện chủ đề học tậpbáo cáo khoa học y họcbáo cáo chính trị thế giớiy học thể dục thể thaoBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ