pouring the anatomic portion of a study model

... repeats are apparently translated to form poly-asparagine, which makes up a substantial fraction of some proteins The description of the whole genome allows the large scale of these repeats in ... amoeba whose genome has recently been sequenced [5] Entamoeba is an intestinal parasite of mammals, causing diseases such as amoebic dysentery - an antisocial amoeba to Dictyostelium’s social amoeba, ... from the animal lineage before fungi and yeasts, but after plants From the point of view of its use as a model organism, the evolutionary distance between Dictyostelium and human is actually...

Ngày tải lên: 14/08/2014, 14:21

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... different model on the Lancaster Treebank data set The models used in this evaluation were trained with observation data from the Lancaster Treebank training set The training set and testing set are...

Ngày tải lên: 08/03/2014, 02:21

... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... purchased from a local seafood market They were acclimated in the laboratory at 25–28 °C in an indoor aquarium for days before rMeMIH-B or dsRNA injection The GSI was calculated as the percentage...

Ngày tải lên: 16/03/2014, 05:20

... the mathematical model at the heart of the IOF Allocator and its implementation are included in Appendixes A and B Here we will cover the details of the data and constraints in the model The allocation ... insofar as the data can be assumed to be the best possible at the time of the decision, a reasonable analysis may be to understand the affects of poor data on the solution For instance, after the ... high-value targets by raising the future value of those weapons The target laydown contains the same information as the shooter laydown in addition to a value and a unit area for each target The values...

Ngày tải lên: 23/03/2014, 02:20

... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... globalization and advances in technology will have a direct impact on talent, and there are notable ties between what participants had to say about the role of internal audit and the changes they ... risk assurance and thus move up the vertical axis of the Internal Audit 2012 Value Model to demonstrate more value Some proactive internal audit groups have already taken the lead in the area of...

Ngày tải lên: 23/03/2014, 04:20

... generalized to the whole elderly population of France MSY was the main investigator and analysed the data and wrote the first draft AI and CR contributed to the study design and the analysis AM ... Questionnaire (GHQ-12): translation and validation study of the Iranian version Health Qual Life Outcomes 2003, 1:66 Campbell A, Knowles S: A confirmatory factor analysis of the GHQ12 using a large Australian ... contributed to the analysis and wrote the final manuscript All authors read and approved the final manuscript Acknowledgements We are grateful to all those who participated in the study References...

Ngày tải lên: 18/06/2014, 19:20

... diagram of the application of a nonlinear canceler of the hybrid echo for an ADSL transceiver system tones in the input signal and of a finite number of samples for the estimation of the model parameters ... [n] The Cramer-Rao bound is the theoretical lower bound for ˆ the variance of all unbiased estimators θ for the model parameters θ and is determined by the diagonal elements of the inverse of the ... variance σu = 0.64 The figure reveals that there is a high covariance between the linear parameters and the third-order parameters That corresponds to the known fact that even in the case of a...

Ngày tải lên: 23/06/2014, 01:20

... Amjad Almusaed Archcrea Institute, Aarhus Denmark Part Passive Building Model and Thermal Insulation Improvement of Thermal Insulation by Environmental Means Amjad Almusaed1 and Asaad Almssad2 ... 20% of the area needs high thermal care 80% of the area needs low and middle thermal care Bath room 80% of the area needs high thermal care 20% of the area needs middle thermal care Table The ... room Thermal care level 80% of the area needs high thermal care 20% of the area needs middle thermal care Bed room 85% of the area needs high thermal care 15% of the area needs middle thermal care...

Ngày tải lên: 28/06/2014, 17:20

... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... from the assessed stand, the amount of precipitation, air temperature and radiation were monitored in the open area To evaluate phenological data for the characterized period, arithmetic mean, maximum...

Ngày tải lên: 07/08/2014, 03:22

... has been stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported ... 50:636-641 Akino K, Kondo Y, Ueno A, Yamazaki K, Hosokawa M, Shimozi H, Adachi T, Honda S, Ichiyanagi S, Akahonai Y, Fujisawa Y, Takahashi H, Arimura Y, Endo T, Imai K: Carcinoma of duodenum arising ... depicting a mass Computed tomography of the abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal diameter...

Ngày tải lên: 09/08/2014, 07:21

... Evolution of the ATP transporter family based on available amino acid sequences from a range of microsporidian parasites 1, Putative ancestral duplication of ATP transporters within the microsporidia ... uncultivatable organisms from which only a handful of contaminant-free DNA can be extracted Finally, an important goal of the present study was to gather a large amount of genome sequence information ... Kamaishi T, Hashimoto T, Nakamura Y, Nakamura F, Murata S, Okada N, Okamoto K, Shimizu M, Hasegawa M: Protein phylogeny of translation elongation factor EF-1 alpha suggests microsporidians are...

Ngày tải lên: 09/08/2014, 20:20

... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... for the appropriate expression of a sizable portion of mRNAs regulated by PMA In our transcriptional profiling data, PMA treatment and cyclin T1 knock-down are two major variables in the RNA samples ... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed...

Ngày tải lên: 13/08/2014, 09:20

... of all bacteremia cases), certain high-risk patients have much higher rates approaching 27% as outlined in this study Risk stratification by application of the validated risk model can have a ... have a profound impact on early therapy and intervention in these cases The role of early appropriate therapy has become important as inappropriate or delayed therapy leads to higher mortality [8-10] ... candidemia, studies have show that delayed therapy can lead to a higher mortality in hospitalized patients with late candidemia [11] Early identification of these patients therefore becomes paramount...

Ngày tải lên: 13/08/2014, 19:20

... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors reviewed...

Ngày tải lên: 14/08/2014, 08:20

... via a multi-scale approach (Fig 1.2) that combines ab initio quantum mechanical calculations with molecular dynamics and thermodynamic analysis In particular, we use the GAUSSIAN [13] software ... great joy to be affiliated with professionals from the Department of Chemical and Biomolecular Engineering at the National University of Singapore In particular, I am indebted to Prof Raj Rajagopalan ... dynamics simulation, they were able to calculate the multiplicity of their system, W, in terms of the CO dipole angle the urea molecules make with the surface normal of the crystal slab They then...

Ngày tải lên: 10/09/2015, 09:11

... ie aj → B ∗ Th e n d( b∗ , aj ) ≤ fo r a ll b∗ ∈ B ∗ im p lie s B ∗ → a; a n d fo r a ll al ∈ A \ {aj }, d( al , aj ) ≤ im p lie s al → a Th is m e a n s t h a t A = {aj } a n d A = A \ {aj ... o t a c o -p a ir Fo r e a c h bi ∈ B, le t Si = O( bi ) ∩ A W e a ls o le t A = {ai |ai → a in F } a n d A = A \ A L ike wis e , B = {bj |bj → b in F }, B = B \ B , A = {ai |b → in F } a n ... p a s s o n t o e a c h o t h e r , a s m u c h s c a n d a l a s t h e y kn o w a t t h a t t im e H o w m a n y c a lls a r e n e e d e d b e fo r e a ll la d ie s kn o w a ll t h e s c a...

Ngày tải lên: 12/09/2015, 21:07

... Data The position data gathered from the Polaris is in millimeters The units are already acceptable but similar to that of the original orientation data, the gathered data is the position of the ... data Section 4.4 Data Gathered The data gathered from this part of the experiments are again raw data The numbers are in millimeters for the position data and in degrees for the orientation data ... for the bus, the data is written at an address bytes away from the base address The receiver card then puts this data to the address that was given to the base address void wrtdata (int baseadd,...

Ngày tải lên: 26/09/2015, 10:13

... the per capita birth rate of the population, µ is the per capita disease-free death rate and ρ is the excess per capita death rate of infective class, β is the effective per capita contact rate, ... individuals who are capable of contracting the disease and becoming infective, • (I), the infective class, i.e., the class of those individuals who are capable of transmitting the disease to others, ... implies the ergodicity of the diffusion as well as the convergence in total variation of the transition probability to the invariant measure (see [6, 15]) As a result we have the following theorem...

Ngày tải lên: 12/10/2015, 10:41

... fulfill the evolving political agendas in the colonial and postcolonial periods through the propagation of various meanings It is also the representational realm that has elevated the City Hall façade ... Parade held at National Stadium First National Day Parade held at Padang EVENTS 1989 2005 2006 City Hall vacated by Academy of Law; Building announced to be turned into a national art museum Administrative ... the Wrapping of the Reichstag”, in Assemblage (Vol 29, April 1996), pp.40-71 Shamsul, A. B A History of an Identity, an Identity of a History: The Idea and Practice of ‘Malayness’ in Malaysia...

Ngày tải lên: 12/10/2015, 17:34

... for the national day parade in 1998 (Figures 3,4&5) The majority of these images feature the City Hall façade as a stageset to the national day parade And in the imaging of the façade as stageset, ... completion, the stadium hosted its first national day parade By 1985, it was designated as a fixed parade venue that was to be alternated with the Padang.7 Crucially, as part of the national day parade ... monumental steps of the façade, rendering it an active participant in the parades Transcending its role as an architectural setting, the façade takes on the function of a stageset The City Hall façade...

Ngày tải lên: 12/10/2015, 17:34