Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx
... some projects, mainly in the medicine specialty of the medical sector (8.9%)Although QAAP is one of the six projects of the HEEP,8.9% of the medical sector projects of the HEEPF addressed the ... CentralPage 1 of 8(page number not for citation purposes)Human Resources for HealthOpen Access Review Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian ... conclusion, educational enhancement in the medical sector in Egypt could be apparently achieved through the HEEPF competitive projects. A study of the long-term impact of these projects on the quality of education...
- 8
- 697
- 0
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx
... 10.1186/1478-4491-8-15Cite this article as: Tjoa et al., Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia Human Resources for Health 2010, 8:15Received: ... goals by 2018: a quantitative analysis of policy options in ZambiaAaron Tjoa*1, Margaret Kapihya2, Miriam Libetwa2, Kate Schroder1, Callie Scott4, Joanne Lee3 and Elizabeth McCarthy1AbstractBackground: ... Correspondence: atjoa@clintonfoundation.org1 Clinton Health Access Initiative, Boston, USAFull list of author information is available at the end of the article Tjoa et al. Human Resources for Health...
- 10
- 427
- 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA CTATCAATGCTCCTACTC-CTAATTTATAATCTAAATTTAACATCTC. ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu- R5-F, GGATCCATGTTAAATTTA-GATTATAAATTAGGAGTA GG and Vpu- R5-R, GAAT-TCATTACAAATCATTAACATCCAAAAGCC. The amplifiedfragments designated as ... AGTAGTAGCAATAATAATAGCAATAGCTGTGT-GGTCCATAGTAATCATAGAATAGG and NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG...
- 11
- 436
- 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... AccessResearch Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in IrelandJohn F Menton*, Karen Kearney and John G MorganAddress: ... hospitals.Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developedbased on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validatedusing a ... assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concludedthat the predominant genotype circulating in these...
- 8
- 535
- 1
Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt
... made available soon. Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself Energy, Sustainability and ... be evaluated according to the climate protection effects achieved. For example, these evaluations are undertaken on the basis of the biomass potential, the energy and material balance of conversion ... tasks are, among others, the determination of the potential by means of humus balancing, the analysis of climate impacts and the techno-economic analysis of the different straw providing pathways....
- 19
- 559
- 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
... 9:36http://www.translational-medicine.com/content/9/1/36Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusHaddad et al.Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virusDana Haddad1,2†, Nanhai ... article as: Haddad et al.: Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus. Journal of...
- 14
- 490
- 0
Báo cáo sinh học: "Review of the 25th Annual Scientific Meeting of the International Society for Biological Therapy of Cancer (now the Society for Immunotherapy of Cancer)" potx
... leaders in the field, the 25th Annual Meeting of the International Society for Biological Therapy of Cancer (iSBTc, recently renamed the Society for Immunotherapy of Cancer, SITC) provided a scientific ... Guiding cancer immunotherapy from bench to bedside Review of the 25th annual scientific meeting of the International Society for Biological Therapy of Cancer Balwit et al.Balwit et al. Journal of ... D.C. Review of the 25th Annual Scientific Meeting of the International Society for Biological Therapy of Cancer (now the Society for Immunotherapy of Cancer) Interaction ã Innovation ã Integration...
- 10
- 474
- 0
Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx
... the resultin Theorem KX true in the framework of the much general Banach space?Osilike et al. [5] proved the convergence theorems of modified Mann iteration method in the framework of q-uniformly ... to p, then Tx = p.Kim and Xu [6] studied weak and strong convergence theorems for the class of asymptotically κ-strictly pseudocontractive mappings in Hilbert space. They obtained a weak convergence theorem ... Convergence of the modified Mann’s iterative method for asymptotically κ-strictly pseudocontractive mappingsYing Zhang∗,1,2and Zhiwei Xie31School of Mathematics and Physics,North...
- 14
- 308
- 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. DiscussionWe have developed a TaqMan probe-based QPCR assay toquantitate the viral load of macaque rhadinoviruses belonging ... assay. The RV-2 QPCR assay was negative for these templates under the standard reaction conditions.Identification of a novel RV2 rhadinovirus in Macaca fascicularis using the RV2 QPCR assay Since ... 6. RV2 QPCR screen of the prevalence of RV2 rhadinoviruses in macaques housed at the WaNPRCDNA samples were obtained from PBMC of a randomassortment of thirty macaques housed at the WaNPRCand...
- 12
- 509
- 0
Báo cáo y học: "Estimated intelligence quotient in anorexia nervosa: a systematic review and meta-analysis of the literature" pot
... quotient in anorexia nervosa: a systematic review and meta-analysis of the literature. Annals of General Psychiatry 2010 9:40.Submit your next manuscript to BioMed Central and take full advantage ... anorexia nervosa: a systematic review and meta-analysis of the literatureCarolina Lopez1,2, Daniel Stahl1, Kate Tchanturia1*AbstractBackground: It has been hypothesised that people with anorexia nervosa ... search of the papers, supervision/interpretation of data and drafted the main part of the manuscript. Allauthors approved the final manuscript.Competing interests The authors declare that they...
- 10
- 525
- 0
báo cáo khoa học: " Overview of the VA Quality Enhancement Research Initiative (QUERI) and QUERI theme articles: QUERI Series" docx
... underutilized.In 1998, the U.S. Department of Veterans Affairs' (VA) Quality Enhancement Research Initiative (QUERI) wasestablished to improve the quality of VA healthcarethrough the use of research- derived ... reflections on the potentialvalue of QUERI and its related approaches from the per-spective of both VA (non -QUERI) leadership and non -VA stakeholders.ConclusionDevelopment and use of QUERI& apos;s ... co-editor of the Series. The articles in the QUERI Series describe implementation research conductedwithin the Health Services Research and Development(HSR&D) Service of the U.S. Department of...
- 9
- 238
- 0
Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx
... matrices of genetic distances based on genotypes at supposedly neutral markers on the one hand, and at markers in QTL regions, on the other hand, showed thatnone of the markers in the QTL regions ... that helps to distinguish the in uence of selection from the in uence of drift.Here, we investigate the joint evolution ofneutral and selected genomic regions, using observations on microsatellite ... genotypes at all markers in QTL regions, on the other hand.2.4. Evolution of marker polymorphism within lines 2.4.1. Temporal changes in allele frequencies In order to d etect markers for which the evolution...
- 23
- 319
- 0
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt
... production. genetic longitudinal data analysis / score test / goodness -of- fit measure / covariance struc-ture1. INTRODUCTION The analysis of longitudinal data in genetic studies is attracting increasingattention. ... articleUse of the score test as a goodness -of- fit measure of the covariance structure in genetic analysis of longitudinal dataFlorence JAFFRÉZIC a, b∗, Ian M.S. WHITE a ,Robin THOMPSONc a Institute ... actual covariance structure is available. The score test approachdoes not require the knowledge of a reference model, and the score statistic has a meaningfulinterpretation in itself as a goodness -of- fit...
- 14
- 324
- 0
Báo cáo sinh học: "Analysis of the real EADGENE data set: Comparison of methods and guidelines for data normalisation and selection of differentially expressed genes (Open Access publication)" potx
... 10.1051/gse:2007029Original articleAnalysis of the real EADGENE data set: Comparison of methods and guidelines for data normalisation and selection of differentially expressed genes (Open Access publicatio n)Florence ... of differentially expressed genes. For each of these steps, the techniques used by the workshop participants will be presented and compared.2. MATERIALS AND METHODS 2.1. Presentation of the data 2.1.1. ... microarrays in total). The EADGENE partners who provided the data were RIBFA and the Roslin Institute. Detection of differentially expressed genes 6372.2. Normalisation of the data 2.2.1. Data quality...
- 18
- 361
- 0
Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc
... www.gse-journal.orgDOI: 10.1051/gse:2007030Original article Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)Peter Sørensena∗, Agnès Bonnetb,BartBuitenhuisa, ... associations between the genes and the phe-notype of interest. Although the purpose of these methods is the same they arequite different in terms of methodology and in the genes included in the anal-ysis. ... scaled and centred. Data from the E. coli data set is shown on the left, and from the S. aureus data set on the right. Multivariate gene expression analyses 6532. MATERIALS AND METHODSAn EADGENE...
- 18
- 291
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtp1 học sinh 1 at context size 3 5 or 7 this means the first word in system output is the synonym of học sinh in case of the context size is equal 3 5 and 7relative earnings of the population with tertiary education upper secondary and post secondary non tertiary education 1002d 3d half bird s eye view of ground penetrating radar data set in archaeology and cultural heritagebáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ