Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

... some projects, mainly in the medicine specialty of the medical sector (8.9%) Although QAAP is one of the six projects of the HEEP, 8.9% of the medical sector projects of the HEEPF addressed the ... Central Page 1 of 8 (page number not for citation purposes) Human Resources for Health Open Access Review Review of the utilization of HEEPF...

Ngày tải lên: 18/06/2014, 17:20

8 697 0
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

... 10.1186/1478-4491-8-15 Cite this article as: Tjoa et al., Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia Human Resources for Health 2010, 8:15 Received: ... goals by 2018: a quantitative analysis of policy options in Zambia Aaron Tjoa* 1 , Margaret Kapihya 2 , Miriam Li...

Ngày tải lên: 18/06/2014, 17:20

10 428 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... R5- TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT- GGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATT- GCTATGATTAGTGCTA CTATCAATGCTCCTACTC- CTAATTTATAATCTAAATTTAACATCTC. ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu- R5-F, GGATCCATGTTAAATTTA- GATTATAAATTAGGAGTA GG and Vpu- R5-R, GAAT- TCATTACAAATCATTAA...

Ngày tải lên: 18/06/2014, 18:20

11 436 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

... Access Research Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland John F Menton*, Karen Kearney and John G Morgan Address: ... hospitals. Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on...

Ngày tải lên: 18/06/2014, 18:20

8 535 1
Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt

Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt

... made available soon. Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself Energy, Sustainability and ... be evaluated according to the climate protection effects achieved. For example, these evaluations are undertaken on the basis of the biomass po...

Ngày tải lên: 18/06/2014, 18:20

19 559 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx

... 9:36 http://www.translational-medicine.com/content/9/1/36 Page 4 of 14 Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus Haddad et al. Haddad ... Open Access Insertion of the human sodium iodide symporter to facilitate...

Ngày tải lên: 18/06/2014, 19:20

14 490 0
Báo cáo sinh học: "Review of the 25th Annual Scientific Meeting of the International Society for Biological Therapy of Cancer (now the Society for Immunotherapy of Cancer)" potx

Báo cáo sinh học: "Review of the 25th Annual Scientific Meeting of the International Society for Biological Therapy of Cancer (now the Society for Immunotherapy of Cancer)" potx

... leaders in the field, the 25th Annual Meeting of the International Society for Biological Therapy of Cancer (iSBTc, recently renamed the Society for Immunotherapy of Cancer, SITC) provided a scientific ... Guiding cancer immunotherapy from bench to bedside Review of the 25th annual scientific meeting of the International Societ...

Ngày tải lên: 18/06/2014, 19:20

10 474 0
Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx

Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx

... the result in Theorem KX true in the framework of the much general Banach space? Osilike et al. [5] proved the convergence theorems of modified Mann iteration method in the framework of q-uniformly ... to p, then Tx = p. Kim and Xu [6] studied weak and strong convergence theorems for the class of asymptotically κ-strictly pseudocontractive mappings in Hilbert sp...

Ngày tải lên: 18/06/2014, 22:20

14 308 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. Discussion We have developed a TaqMan probe-based QPCR assay to quantitate the viral load of macaque rhadinoviruses belonging ... assay. The RV-2 QPCR assay was negative for these templates under the standard reaction conditions. Identification of a novel RV2...

Ngày tải lên: 18/06/2014, 22:20

12 510 0
Báo cáo y học: "Estimated intelligence quotient in anorexia nervosa: a systematic review and meta-analysis of the literature" pot

Báo cáo y học: "Estimated intelligence quotient in anorexia nervosa: a systematic review and meta-analysis of the literature" pot

... quotient in anorexia nervosa: a systematic review and meta-analysis of the literature. Annals of General Psychiatry 2010 9:40. Submit your next manuscript to BioMed Central and take full advantage ... anorexia nervosa: a systematic review and meta-analysis of the literature Carolina Lopez 1,2 , Daniel Stahl 1 , Kate Tchanturia 1* Abstract Background...

Ngày tải lên: 09/08/2014, 01:21

10 525 0
báo cáo khoa học: " Overview of the VA Quality Enhancement Research Initiative (QUERI) and QUERI theme articles: QUERI Series" docx

báo cáo khoa học: " Overview of the VA Quality Enhancement Research Initiative (QUERI) and QUERI theme articles: QUERI Series" docx

... underutilized. In 1998, the U.S. Department of Veterans Affairs' (VA) Quality Enhancement Research Initiative (QUERI) was established to improve the quality of VA healthcare through the use of research- derived ... reflections on the potential value of QUERI and its related approaches from the per- spective of both VA (non -QUERI) leadership and...

Ngày tải lên: 11/08/2014, 16:21

9 238 0
Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx

Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx

... matrices of genetic distances based on genotypes at supposedly neutral markers on the one hand, and at markers in QTL regions, on the other hand, showed that none of the markers in the QTL regions ... that helps to distinguish the in uence of selection from the in uence of drift. Here, we investigate the joint evolution ofneutral and selecte...

Ngày tải lên: 14/08/2014, 13:21

23 319 0
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt

Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt

... production. genetic longitudinal data analysis / score test / goodness -of- fit measure / covariance struc- ture 1. INTRODUCTION The analysis of longitudinal data in genetic studies is attracting increasing attention. ... article Use of the score test as a goodness -of- fit measure of the covariance structure in genetic analysis of longit...

Ngày tải lên: 14/08/2014, 13:22

14 324 0
Báo cáo sinh học: "Analysis of the real EADGENE data set: Comparison of methods and guidelines for data normalisation and selection of differentially expressed genes (Open Access publication)" potx

Báo cáo sinh học: "Analysis of the real EADGENE data set: Comparison of methods and guidelines for data normalisation and selection of differentially expressed genes (Open Access publication)" potx

... 10.1051/gse:2007029 Original article Analysis of the real EADGENE data set: Comparison of methods and guidelines for data normalisation and selection of differentially expressed genes (Open Access publicatio n) Florence ... of differentially expressed genes. For each of these steps, the techniques used by the workshop participants wil...

Ngày tải lên: 14/08/2014, 13:22

18 361 0
Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc

Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc

... www.gse-journal.org DOI: 10.1051/gse:2007030 Original article Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication) Peter Sørensen a∗ , Agnès Bonnet b ,BartBuitenhuis a , ... associations between the genes and the phe- notype of interest. Although the purpose of these methods is the same they are...

Ngày tải lên: 14/08/2014, 13:22

18 291 0
w