Báo cáo sinh học: "Reduction of inbreeding in commercial females by rotational mating with several sire lines" ppsx

... Access Review Impact of an in- built monitoring system on family planning performance in rural Bangladesh Humayun Kabir*, Rukhsana Gazi, Ali Ashraf and Nirod Chandra Saha Address: Health Systems and Infectious ... provision of door-step injectables, and strengthening of the management information system (MIS). The impact of an in- built monitoring sy...

Ngày tải lên: 18/06/2014, 17:20

... Journal Open Access Methodology Discovery of herpesviruses in multi-infected primates using locked nucleic acids (LNA) and a bigenic PCR approach Sandra Prepens 1 , Karl-Anton Kreuzer 2 , Fabian ... of the second round of the pan-herpes DPOL PCR. It overlaps with the LNA-based and bigenic amplification of beta- and gammaherpesvirusesFigure 1 LNA-ba...

Ngày tải lên: 18/06/2014, 18:20

... emissions benefits are examined simultaneously. Existing studies on this topic often focus on the impact of dietary choices either on energy and emissions or on the availability of land, e.g., in ... accounting Definition of the goal and scope for energy accounting in conventional agriculture in Austria In line with the goal definition an...

Ngày tải lên: 18/06/2014, 18:20

... full text (HTML) versions will be made available soon. Encapsulation of docetaxel in oily core polyester nanocapsule intended for breast cancer therapy Nanoscale Research Letters 2011, 6:630 doi:10.1186/1556-276X-6-630 Ibrahima ... in oily core polyester nanocapsule intended for breast cancer therapy Ibrahima Youm 1 , Xiao Y Yang 1 , James B Murowc...

Ngày tải lên: 18/06/2014, 22:20

... high- Effect of inhibitors on in vitro processingFigure 4 Effect of inhibitors on in vitro processing. Various con- centrations of protease inhibitors were added to the in vitro processing assay for ... Central Page 1 of 8 (page number not for citation purposes) Virology Journal Open Access Research Development of an in vitro cleavage assay system to...

Ngày tải lên: 19/06/2014, 08:20

... balance, Long et al. in a recent article in BMC Evolutionary Biology [2] have investigated the influence of the inflammatory response on the severity of disease in a rodent model of malaria, and we ... mostly in children under the age of 5 living in sub-Saharan Africa. And yet the number of malaria infections which go on to become life threatening is proportionally very sm...

Ngày tải lên: 06/08/2014, 18:21

... All five of the long-lived mutants had increased pools of amino acids, especially of the branched-chain amino acids isoleucine, leucine and valine, together with phenylalanine and tyrosine. A ... similar increase in branched-chain amino acids has been found in animals carrying mutations in components of Abstract The nematode Caenorhabditis elegans is a favorite model f...

Ngày tải lên: 06/08/2014, 19:21

... undergo purging as populations which experience a slow rate of increase in inbreeding over time are more likely to show the effects of purging [24] and the rate of increase of inbreeding in the Irish ... affect the inbreeding effect. Favourable coefficients for the inter- action suggest the occurrence of purging of inbreeding depression for that trait...

Ngày tải lên: 14/08/2014, 13:21

... line and female fertility in a female line with appropriate levels of selection pressure, but both compo- nents are important in line multiplication and in increas- ing selection intensity in ... result in a decline in fertility or in the ability of the males to mate efficiently [2,3]. Therefore, balanced selection should be aimed at improving key life performance traits...

Ngày tải lên: 14/08/2014, 13:21

... cited. Research Heritability of longevity in Large White and Landrace sows using continuous time and grouped data models Gábor Mészáros* 1 , Judit Pálos 1 , Vincent Ducrocq 2 and Johann Sölkner 1 Abstract Background: ... continuous time and grouped data models in Large White and Landrace sows were examined. Risk of culling associated wi...

Ngày tải lên: 14/08/2014, 13:21

... in cM Haldane (see Tab. I). Genet. Sel. Evol. 35 (2003) 77101 77 â INRA, EDP Sciences, 2003 DOI: 10.1051/gse:2002037 Original article Detection of genes in uencing economic traits in three French ... world. In this paper, we present the results of a large QTL detection experiment carried out in the French dairy cattle AI populations. QTL detection in...

Ngày tải lên: 14/08/2014, 13:21

... of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene Solange S OULIER a , Marthe ... using the BAC DNA as the template and oligos 5  GGTCGACTTATATATTTATGAACACATTTA 3  and 5  CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCT-...

Ngày tải lên: 14/08/2014, 13:22

... long-term inbreeding of the com- mercial females, irrespective of the effective size of each sire line. Oscillation of the inbreeding coefficient under rotational mating with initially related sire lines ... of the effective size of each sire line. When the sire lines are initially related, an oscillation of the inbreeding coefficient may occur in commercial...

Ngày tải lên: 14/08/2014, 13:22

... Assessment of inbreeding by DNA fingerprinting: development of a calibration curve using defined strains of chickens. Genetics 125, 161-165 the main problem lies in finding a highly ... 2 and 3 must be calculated according to the number of Original article Estimation of relatedness in natural populations using highly polymorphic gen...

Ngày tải lên: 14/08/2014, 20:20

... intensity Estimation of heritability in the base population when only records from later generations are available L Gomez-Raya LR Schaeffer EB Burnside University of Guelph, ... the estimation of genetic variance in later generations using the MIVQUE algorithm and assuming that individuals in the generation in question are...

Ngày tải lên: 14/08/2014, 20:20