... Health Open Access Research Workforce analysis using data mining and linear regression to understand HIV/AIDS prevalence patterns Elizabeth A Madigan* 1 , Olivier Louis Curet 2 and Miklos Zrinyi 3 Address: ... predicted values and actual values of HIV/AIDS prevalence rates. The top level discriminators for HIV/AIDS prevalenceFigure 1 The top level discrimina...
Ngày tải lên: 18/06/2014, 17:20
... distribu- tion analysis of physicians against these parameters ena- bles us to obtain a clearer sense of the demand/supply balance of physicians in communities, and to ascertain what their equal distribution ... We regarded variables against which physicians are more equally distributed as better parame- ters of community attractiveness: that is, better parameters o...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Porcine adenovirus type 3 E1Blarge protein downregulates the induction of IL-8" doc
... of porcine adenovirus type 3. Virology 1998, 251:414-426. 19. Zakhartchouk A, Zhou Y, Tikoo SK: A recombinant E1-deleted porcine adenovirus- 3 as an expression vector. Virology 20 03, 31 3 :37 7 -38 6. 20. ... regulate the transcription of some chemokines [7, 23] . To determine the effect of PAdV -3 E1 proteins on the induction of chemokines, HeLa cells were infe...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx
... 9:26 http://www.translational-medicine.com/content/9/1/26 Page 7 of 13 RESEARCH Open Access Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear ... of apoptosis (Annexin V+, 7AAD-) and (B) late stages of apoptosis (Annexin V+,...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " How do medical students value health on the EQ-5D? Evaluation of hypothetical health states compared to the general population" ppt
... perception of health and therefore value health states differently compared to the general population. In this study we describe how medical students value hypothetical health states in comparison to ... valuations of the general population of Germany [12]. There were no significant differences between the VAS scores of medical students and t...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Soilborne wheat mosaic virus (SBWMV) 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing" docx
... (SBWMV) 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing Jeannie Te 1 , Ulrich Melcher 2 , Amanda Howard 1 and Jeanmarie Verchot- Lubicz* 1 Address: 1 Department ... Johnson KL, Garcia-Sastre A, Ball LA, Palese P, Ding SW: Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silenci...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Respiratory syncytial virus-induced acute and chronic airway disease is independent of genetic background: An experimental murine model" pot
... Access Research Respiratory syncytial virus-induced acute and chronic airway disease is independent of genetic background: An experimental murine model Susana Chávez-Bueno 1 , Asunción Mejías 1 , Ana M Gómez 2 , ... RSV-induced acute and chronic airway disease is reproducible in two geneti- cally distinct mouse strains. The long-term airway disea...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: "Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" pot
... we have utilized tandem mass spectrometry (MS) to analyze the protein composition of the vaccinia virion. A comprehensive proteome analysis of the protein composition of the VV virion represents ... BioMed Central Page 1 of 16 (page number not for citation purposes) Virology Journal Open Access Research Pox proteomics: mass spectrometry analysis and identificatio...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: "Research Article Parameter Identification and Synchronization of Dynamical System by Introducing an Auxiliary Subsystem" doc
... Corporation Advances in Difference Equations Volume 2010, Article ID 808403, 12 pages doi:10.1155/2010/808403 Research Article Parameter Identification and Synchronization of Dynamical System by Introducing an ... estimator. 4. Parameter Identification in the Presence of Noise Noise plays an important role in synchronization and parameters identification of...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo sinh học: "Trends in antibiotic susceptibility patterns and epidemiology of MRSA isolates from several hospitals in Riyadh, Saudi Arabia" doc
... total of 512 MRSA isolates were procured from 6 major hospitals in Riyadh, Saudi Arabia and antibiotic susceptibilities and MICs were documented against several antibiotics and vancomycin. SPSS ... down-regulation of certain penicil- lin-binding proteins, including PBP2A. Quinupristin/dalfopristin (Synercid) is a semisynthetic antibiotic that combines two strepto...
Ngày tải lên: 08/08/2014, 19:20
Báo cáo sinh học: " Macrogeographic patterns in B-chromosome and inversion polymorphisms of the grasshopper" pps
... inversions and B-chromosomes. Previous studies revealed the existence of altitudinal, latitudinal and longitudinal clines for 9 chromosomal sequences, whose repetition in independent ... (Orthoptera- Acridoidae-Oedipodinae). Rev Per Entom 14, 2 Original article Macrogeographic patterns in B-chromosome and inversion polymorphisms of the gras...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo sinh học: " Genetic variability within French race and riding horse breeds from genealogical data and blood marker polymorphisms" potx
... and even smaller than in Arab, which clearly had a smaller total number of founders. Original article Genetic variability within French race and riding horse breeds from ... heterozygosity between French and American Throughbred or between French and American Arab. The links between results from blood marker data and results...
Ngày tải lên: 09/08/2014, 18:22
Báo cáo sinh học: "Challenges in experimental data integration within genome-scale metabolic models" ppt
... modeling several other metabolic processes in humans. He specifically investi- gated the metabolic and regulatory underpinnings of dia- betes, combining the knowledge on regulatory and metabolic ... directionalities in genome-scale metabolic models using available thermo- dynamic information. Another criticism often addressed to FBA pertains to the use of an optimality principle...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo sinh học: " Bootstrapping of gene-expression data improves and controls the false discovery rate of differentially expressed genes" ppsx
... variance for their false discovery rates of differentially expressed genes. The false discovery rates were empirically assessed by finding the differentially expressed genes in a first data set, and confirming ... 10.1051/gse:2003058 Original article Bootstrapping of gene-expression data improves and controls the false discovery rate of differentia...
Ngày tải lên: 14/08/2014, 13:22