Báo cáo sinh học: " Principal component approach in variance component estimation for international sire evaluation" pps

... cphA:forward,GCGATA CCATGG TATCCGAATTCCAAG and reverse, ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; ... CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CT...

Ngày tải lên: 08/03/2014, 23:20

... Access Review Impact of an in- built monitoring system on family planning performance in rural Bangladesh Humayun Kabir*, Rukhsana Gazi, Ali Ashraf and Nirod Chandra Saha Address: Health Systems and Infectious ... provision of door-step injectables, and strengthening of the management information system (MIS). The impact of an in- built monitoring sy...

Ngày tải lên: 18/06/2014, 17:20

... Central Page 1 of 10 (page number not for citation purposes) Human Resources for Health Open Access Research Human resource management in the Georgian National Immunization Program: a baseline assessment LauraCEsmail* 1 , ... obtain vaccines from the CPH. Discussion The findings of this study are based on the human resource management structure and practice...

Ngày tải lên: 18/06/2014, 17:20

... Resources for Health Open Access Research Mid-level providers in emergency obstetric and newborn health care: factors affecting their performance and retention within the Malawian health system Susan ... regarding the factors affecting their performance and retention within the Malawian health system and addressed the following...

Ngày tải lên: 18/06/2014, 17:20

... post-secondary institutions in planning and implementing responses to existing and emerging health care workforce needs. In this commentary, we outline strategies we have found successful in aligning health ... factor in BioMed Central Page 1 of 7 (page number not for citation purposes) Human Resources for Health Open Access Commentary Conditions underpinning success in joi...

Ngày tải lên: 18/06/2014, 17:20

... citation purposes) Human Resources for Health Open Access Research Evidence-based practice in neonatal health: knowledge among primary health care staff in northern Viet Nam Leif Eriksson* 1 , Nguyen ... all infant deaths [19]. In 2003, the Ministry of Health in Viet Nam adopted a groundbreaking initiative to improve neonatal health care by launchi...

Ngày tải lên: 18/06/2014, 17:20

... Buchan et al.: Continuity and change in human resources policies for health: lessons from Brazil. Human Resources for Health 2011 9:17. Submit your next manuscript to BioMed Central and take full ... attracting and retaining hea lth staff in remote and/ or rural areas, tackling staff mal-distribution and over-specialisation, particularly in the physician...

Ngày tải lên: 18/06/2014, 17:20

... Journal Open Access Methodology Discovery of herpesviruses in multi-infected primates using locked nucleic acids (LNA) and a bigenic PCR approach Sandra Prepens 1 , Karl-Anton Kreuzer 2 , Fabian ... of the second round of the pan-herpes DPOL PCR. It overlaps with the LNA-based and bigenic amplification of beta- and gammaherpesvirusesFigure 1 LNA-ba...

Ngày tải lên: 18/06/2014, 18:20

... almost the same estimation performance for −40 and 40 dB and obtain better results for G SR /G RD = 0dB as in the individual channel estimation case. We show the BER performance for G SR /G RD ={−40, ... time-varying model for the CO -OFDM channels where the parameters may change during one transmit symbol [12], based on the time- frequency approach. 3. Time-Varying Channel...

Ngày tải lên: 21/06/2014, 16:20

... expression as a random variable, and construct the distribution of the gene expressions of gene i. We then c hoose a subset of genes whose distri- butions of the gene expressions belong to the common Weibull ... individual gene on the follicular lymphoma data set comes from the Weibull distribution, and found 471 gene s whose distributions of gene ex pressions belong to...

Ngày tải lên: 12/08/2014, 17:20

... Martinez Original article Further insights of the variance component method for detecting QTL in livestock and aquacultural species: relaxing the assumption of additive effects Victor MARTINEZ * Faculty ... of detecting dominance in the second stage, according to the conditional model (first estimating the most likely position of the QT...

Ngày tải lên: 14/08/2014, 13:21

... http://www.gsejournal.org/content/41/1/55 Page 6 of 8 (page number n ot for citation purposes) Genetics Selection Evolution Research Deregressing estimated breeding values and weighting information for genomic regression analyses Dorian ... individual phenotypic performance, information on progeny, estimated breeding values (EBV) from genetic evalua- tions, or a...

Ngày tải lên: 14/08/2014, 13:21

... RESEARCH Open Access Principal component approach in variance component estimation for international sire evaluation Anna-Maria Tyrisevä 1* , Karin Meyer 2 , W Freddy Fikse 3 , Vincent Ducrocq 4 , ... iry cattle breeding requires accurate and comparable international breeding values for dairy bulls. The international Bull Evaluation Service, Inter- bull, has for ye...

Ngày tải lên: 14/08/2014, 13:21

... analytic and reduced rank variance models. Aust N Z J Stat 2003, 45:445–459. 12 Principal component and factor analytic models in interna- tional sire evaluation Anna-Maria Tyrisevăa 1 , Karin Meyer 2 , ... upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Principal component and factor analytic models in i...

Ngày tải lên: 14/08/2014, 13:21

... study reports the analysis of synaptonemal complex behaviour in spermatocytes from a bull homozygous carrier for the 1;29 Robertsonian translocation. MATERIALS AND METHODS The 1;29 Robertsonian ... Robertsonian translocation carrier examined in this study was a Blonde d’Aquitaine bull. After hemicastration of the bull, the removed...

Ngày tải lên: 14/08/2014, 20:20