Báo cáo sinh học: " Modeling relationships between calving traits: a comparison between standard and recursive mixed models" ppt

... 42:1 http://www.gsejournal.org/content/42/1/1 Page 5 of 9 RESEARC H Open Access Modeling relationships between calving traits: a comparison between standard and recursive mixed models Evangelina López de Maturana 1,2* , ... (co)variance between sire effects of GL and CD,  h GL 2 and  e G L 2 are the herd-year and residual variances for GL, and  hh GL CD a...

Ngày tải lên: 14/08/2014, 13:21

... estimated genetic and residual covariance matrices. These covariance matrices are traditionally estimated using analytical approximations. A Gibbs sampler for making full Bayesian ... size in Danish Landrace pigs: a Bayesian analysis. Theor Appl Genet 88, 220-230 Wang CS, Quaas RL, Pollak EJ (1995) Bayesian analysis of calving ease scores and b...

Ngày tải lên: 09/08/2014, 18:22

... GUCUGAAGCUCAAUGAUCUC- CUAGACCUCUUUAGUGGAAC- CAAUUAAACUCGUGUACGGAU GGCCGCGGACUGAAUAUCUAG 4 .(((((((((((( (( )) ))))))))).))) 43 CUCGUGAAUAUAACACUCAAG- AUUCAAAAAAAACAAAUCAAA- GACCGAAAUUUAUGUUUAGUGA AAAAGAAAAGUUUUUUUUAGAA 5 ... original RNAinverse [6] Output sequence of modified RNAinverse [6] 1 ((( ((( ((( ))) ((( ))) ))) ))) 45 ACCGCCAGACAGGGCCAAGCCA- UCCAAAUUCAUAGUAUAAUACA- CAUCCUAAGGAAAAGA...

Ngày tải lên: 12/08/2014, 17:20

... proposed a statistical method for detecting risk haplotypes for a complex trait with a random sample drawn from a natural population. Liu et al.'s approach can be used to characterize DNA sequence ... advice and help. RW conceived the model and wrote the paper. AB provided final modifications to the paper. All authors have read and approved the final manuscript. Additional...

Ngày tải lên: 12/08/2014, 17:20

... Tibetan goat, Small-xianggoat), block II (Taihang goat,Neimonggol goat,Liaoning goat)andblock III(Nanjiang Brown goat, Chuandong White goat, Black goat, Wu goat). The Matou goat popula- tion was ... goat had a large number of individuals and broad distributing area. In contrast, the Small-xiang goat existed in a remote area with a small population size and there was less gene exchan...

Ngày tải lên: 14/08/2014, 13:21

... populations of intra-island Fijian and Western Samoan fowls had greater band sharing values and lesser genetic distances, i.e. they were close to each other. In contrast, the inter-island band sharing ... 10.1051/gse:2003031 Original article Evolutionary relationships of Red Jungle Fowl and chicken breeds Irina G. M OISEYEVA a , Michael N. R OMANOV b∗ , Andrey A. N IKIF O ROV a ,...

Ngày tải lên: 14/08/2014, 13:22

... characters J Jordana J Piedrafita, A Sanchez Universitat Aut6noma de Barcelona, Unitat de Genètica i Millora Animal, Departament de Patologia i de Producci6 Animals, Facultat ... Gran Enciclopedia Canina. Planeta - De Agostini, Barcelona Guasp A (1982) Pastor Mallorqufn o Ca de Bestiar. In: I Sym Nac Razas Caninas Espafiolas, Cordoba 19-21 marzo .....

Ngày tải lên: 14/08/2014, 20:20

... gen6tico - taxon6mica en siete ecotipos de la Rasa Aragonesa. IV Jornadas Cientificas, de la Sociedad Espanola de Ovinotecnia, Zaragoza, 7-9 June 1979, Zaragoza, 63-76 Villemont ... means of a hierarchical analysis taking the breeds as OTUs (Swofford and Selander, 1981), a matrix of distances among ancestral trunks is computed, obtaining an ave...

Ngày tải lên: 14/08/2014, 20:20

... that could be considered are: • What ongoing efforts to increase graduate level primary care training have been established in developing coun- tries. What has been their impact and what have ... socially accountable? • What is the status of existing collaborations between developing countries aiming to improve health worker education? • How have modifications in healthcare management had...

Ngày tải lên: 18/06/2014, 17:20

... Negarandeh R, Oskouie E, Ahmadi F, Nikravesh M, Hallberg IR: Patient advocacy: barriers and facilitators. BMC Nursing 2006, 5:3. 32. Dehghan Nayeri N, Nazari A, Salsali M, Ahmadi F, Adib Hajbaghery ... Dehghan Nayeri and Reza Negarandeh* Address: School of Nursing and Midwifery, Tehran University of Medical Sciences, Tehran, Iran Email: Nahid Dehghan Nayeri - nahid.nayeri@gmail.com; Re...

Ngày tải lên: 18/06/2014, 17:20