Báo cáo sinh học: "Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens" potx

Báo cáo sinh học: "Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens" potx

Báo cáo sinh học: "Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens" potx

... the training and testing sets had an average of 33 and 44 progeny, respectively. Family size (half sibs) in the training set ranged between 1 and 284, with the mean and median being 32 and 17, ... strategy described in Misztal and Gianola [29] was adapted to compute the RKHS regressions. Results and discussion Mean adjusted FCR was 1.23 in the training set, with a st...
Ngày tải lên : 14/08/2014, 13:21
  • 10
  • 371
  • 0
Báo cáo sinh học: "Genetic evaluation for a quantitative trait controlled by polygenes and a major locus with genotypes not or only partly known" doc

Báo cáo sinh học: "Genetic evaluation for a quantitative trait controlled by polygenes and a major locus with genotypes not or only partly known" doc

... expectation and variance of the random variables are assumed to be: The linear model is mixed in both the statistical sense (Henderson, 1984), as it contains fixed and random ... assumed that Var (a *) = Var (a) = A - Qa and Var(e * ) = Var(e) = I - Q e. The matrices Q and W are not known and have to be estimated from the data...
Ngày tải lên : 14/08/2014, 19:22
  • 19
  • 236
  • 0
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

... University of Illinois at Urbana-Champaign, Urbana, IL, USA 3 Department of Biochemistry, University of Illinois at Urbana-Champaign, Urbana, IL, USA The use of enzymes as catalysts in industrial and aca- demic ... carrier gas and the peak area was used to calculate conversion based on a standard curve previously prepared from authentic xylitol. Each reaction was performed...
Ngày tải lên : 23/03/2014, 15:20
  • 12
  • 368
  • 0
Báo cáo sinh học: "Bayesian analysis of mixed linear models via Gibbs sampling with an application to litter size in Iberian pigs CS Wang" pdf

Báo cáo sinh học: "Bayesian analysis of mixed linear models via Gibbs sampling with an application to litter size in Iberian pigs CS Wang" pdf

... effects are taken into account in REML. In this sense, a marginal Bayesian analysis with flat priors can be thought of as an analysis of a marginal likelihood, with additional ... simulated data to construct marginal densities of variance components, variance ratios and intraclass correla- tions, and noted that the marginal distribution...
Ngày tải lên : 14/08/2014, 19:22
  • 25
  • 337
  • 0
Báo cáo khoa học: "Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy" pot

Báo cáo khoa học: "Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy" pot

... not replicate or integrate into mammalian chromosomes [12,13]. In particular, the inability of baculoviruses to replicate in mammalian cells makes them attractive candidate vectors for in vitro ... DNA in nonviral vector-mediated gene transfer. EBV is a gamma herpes virus that is maintained as a ~172- kb episome in a small ratio of resting B cells and epithelial cells...
Ngày tải lên : 12/08/2014, 04:20
  • 8
  • 328
  • 0
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt

báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt

... was used as an exploratory data analysis technique to reveal natural grouping from latent patterns in a large data set on the basis of a minimal within-group and a maximal between-group variation, ... technical advances, changes in the public and private health systems, an increasing number of professionals, increasing female enrollment in health professions, and chang...
Ngày tải lên : 18/06/2014, 17:20
  • 9
  • 305
  • 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên : 18/06/2014, 22:20
  • 24
  • 604
  • 0
Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx

Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx

... and remained separated until breeding commenced. Calves remained with their dams until weaning in early October each year. Heifers and cows failing to wean a calf each ... survival rate (probability at a particular age of surviving to the next age, Px); mortality rate (probability at a particular age of dying before the next age,...
Ngày tải lên : 09/08/2014, 18:21
  • 14
  • 314
  • 0
Báo cáo sinh học: "Fast prediction of RNA-RNA interaction" ppt

Báo cáo sinh học: "Fast prediction of RNA-RNA interaction" ppt

... two terminal bases which may be paired or unpaired. A solid vertical line indicates an interaction base pair, a dashed vertical line denotes two terminal bases which may be base paired or unpaired, and ... inter- acting RNAs started by concatenating the two interact- ing RNA sequences and treated them as a single sequence PairFold[6] and RNAcofold[7]. Dirks et al. present a meth...
Ngày tải lên : 12/08/2014, 17:20
  • 10
  • 248
  • 0
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

... “homoge- neous” ) of a selection of known TFs (marked with a star) as well as arbitrary candidate patterns. Several known TFs appear to be highly significant (e.g., TF AAGAAAAA with a P-value of 1.31 × ... distribution of N’ (Poisson approximation or large deviations for example). The drawback of this approach is that N and N’ are clearly two different random variables an...
Ngày tải lên : 12/08/2014, 17:20
  • 18
  • 409
  • 0

Xem thêm