Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

... hidden Markov model 501 Original article The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication) Johann C. DETILLEUX* Quantitative Genetics Group, Department ... simulations and mathematics show that the mixed HMM is appropriate to estimate the quantities of interest although the accuracy of the estim...
Ngày tải lên : 14/08/2014, 13:21
  • 19
  • 388
  • 0
Báo cáo sinh học: " Statistical analysis of ordered categorical data via a structural heteroskedastic threshold model" pdf

Báo cáo sinh học: " Statistical analysis of ordered categorical data via a structural heteroskedastic threshold model" pdf

... JL, San Cristobal M, Gianola D, Im S (1992) Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models. ... is the ML estimate of 1I j , and Above, D* is based on the likelihood ratio statistic for fitting the entertained model against a saturated model having as...
Ngày tải lên : 09/08/2014, 18:22
  • 25
  • 364
  • 0
Báo cáo sinh học : " The importance of mathematics in biology is a matter of perennial debate" pot

Báo cáo sinh học : " The importance of mathematics in biology is a matter of perennial debate" pot

... make sense of the facts, at least in so complex a system as a developing embryo, then facts - and indeed understanding - at many levels must be fed into the mathematics. Nor should the value of ... mathematics; indeed Lewis argues cogently that the behavior of the Hes/her oscillator alone is beyond the reach of simple intuition. Moreover the biological facts, which...
Ngày tải lên : 06/08/2014, 19:20
  • 2
  • 352
  • 0
Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf

Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf

... quasi-score approach of Me Cullagh and Nelder [30] which only requires the mean and variance of the data distribution. In particular, an appealing version of the quasi-score ... components: Original article A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model Florence Jaffrézic,...
Ngày tải lên : 09/08/2014, 18:21
  • 18
  • 297
  • 0
Báo cáo sinh học: " The incidence of polyploidy and mixoploidy in early bovine embryos derived from in vitro fertilization" ppt

Báo cáo sinh học: " The incidence of polyploidy and mixoploidy in early bovine embryos derived from in vitro fertilization" ppt

... (13.7%, Iwasaki et al, 198 9a; 15.5% King, 199 1a; 18-36% Iwasaki and Nakahara, 199 0a, b; 36.3-39.2% Kawarsky et al, 1996). Mixoploidy was the main abnormality observed in the ... incidence of chromosome anomalies found in embryos (Frazer et al, 1976; Maudlin and Frazer, 1977, 1978; Iwasaki and Nakahara, 199 0a) . The cytogenetic analysis o...
Ngày tải lên : 09/08/2014, 18:22
  • 8
  • 463
  • 0
Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot

Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot

... TGAAGC GAATTC TTACTCCAGGTAGAGGTCCCTCT 585–579 C2 for TGAAGC GAATTC TTAGGCGGGGCCAATGATGAC 687–682 Loop back AGCTCG AGATCT GGGTCCTCAGAGGAGAGGAG 448–453 Core 269 back AGCTCG AGATCT TGCCAGCGCGTCAGGTATGGC ... AGCTCG AGATCT ATGGCCGAGGAGCTGGTCTT 1–7 Core back AGCTCG AGATCT AACGCCTGGTGCCCAGCGGA 140–147 Core for TGAAGC GAATTC TTACTCCCTCTCCTCTGAGGACC 454–448 Loop for TGAAGC GAATTC TTAACGGATCCGCATGGCCAT...
Ngày tải lên : 08/03/2014, 09:20
  • 7
  • 506
  • 0
Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

... mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting Alessandra Maleddu 1* , Maria A Pantaleo 1,2 , Margherita Nannini 1 and Guido Biasco 1,2 Abstract Gastrointestinal ... 2011 References 1. Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T, Ishiguro S, Kawano K, Hanada M, Kurata A, Takeda M, Muhammad Tunio G, Matsuzawa Y, Kanakura Y, S...
Ngày tải lên : 18/06/2014, 19:20
  • 8
  • 517
  • 0
Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx

... from animals at different time points of disease from whole pancreata, pancreatic lymph nodes and spleen and spectratyped according to the protocol of Pannetier et al [9]. Total RNA was iso- lated ... detected in the pancreases, with most of the BV families present at pre-diabetic and d iabetic stages. A similar expansion profile of the BV TCR repertoire was also observed...
Ngày tải lên : 18/06/2014, 19:20
  • 10
  • 447
  • 0
Báo cáo sinh học: "Mutational analysis of the potential catalytic residues of the VV G1L metalloproteinase" pptx

Báo cáo sinh học: "Mutational analysis of the potential catalytic residues of the VV G1L metalloproteinase" pptx

... by immunoblot. Mutational analysis of the putative catalytic and zinc-binding residues of G1L utilizing a trans complementation assayFigure 4 Mutational analysis of the putative catalytic and zinc-binding ... containing mutations in and about the active site was created. Transient expression analysis coupled with a trans complementation assay of a conditionally-letha...
Ngày tải lên : 19/06/2014, 08:20
  • 7
  • 317
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... [41]. Amyloid-b After the 4.5 kDa Ab peptide was identified as a major component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease. ... olig- omerization, aggregation and fibrilization that Ab forms amyloid plaques. As amyloid plaques are prom- inent in the postmortem AD brain, early research the- ories pl...
Ngày tải lên : 07/03/2014, 10:20
  • 9
  • 634
  • 0

Xem thêm

Từ khóa: