Báo cáo y học: "Efficacy of tailored-print interventions to promote physical activity: A systematic review of randomised trials" docx

Báo cáo y học: "Efficacy of tailored-print interventions to promote physical activity: A systematic review of randomised trials" docx

Báo cáo y học: "Efficacy of tailored-print interventions to promote physical activity: A systematic review of randomised trials" docx

... 133:673-693. 17. Norman GJ, Zabinski MF, Adams MA, Rosenberg DE, Yaroch AL, Atienza AA: A review of eHealth interventions for physical activity and dietary behavior change. American Journal of Preventive ... computer-tailored education on physical activity and dietary behaviors. Annals of Behavioral Medicine 2006, 31:205-223. 14. Napolitano MA, Marcus BH: Targeting and ta...

Ngày tải lên: 14/08/2014, 08:21

38 183 0
Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

... good for your health? Haworth Pastoral Press, Binghampton: NY; 1997. 39. Fayad F, Lefevre-Colau MM, Poiraudeau S, Fermanian J, Rannou F, Wlodyka Demaille S, Benyahya R, Revel M: Chronicity, recur- rence, ... associated with physical decondi- tioning such as loss of mobility, muscle strength and lowered pain thresholds (allodynia). Consequently, the performance of daily physical activ...

Ngày tải lên: 13/08/2014, 13:22

5 355 0
Báo cáo y học: "Statin prophylaxis and inflammatory mediators following cardiopulmonary bypass: a systematic review" ppsx

Báo cáo y học: "Statin prophylaxis and inflammatory mediators following cardiopulmonary bypass: a systematic review" ppsx

... JJ, Altman DG: Measuring inconsistency in meta-analyses. BMJ 2003, 327:557-560. 15. Nakamura K, Masuda H, Kariyazono H, Arima J, Iguro Y, Yamada K, Sakata R: Effects of atorvastatin and aspirin ... one trial at a dose of 20 mg/day [31]. Fluvastatin was used in one trial at a dose of 80 mg/day [28]. Pravastatin was used in one trial at a dose of 40 mg/day [29]. The duration of...

Ngày tải lên: 13/08/2014, 19:20

11 261 0
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... correspondence: Aer Lingus, Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian, bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines, Cyprus Airways, Czech Airlines, ... data analysis and inter- pretation of the data as well as the writing of the manuscript. FGB participated in the data analysis and interpretation of the study. DS particip...

Ngày tải lên: 25/10/2012, 10:31

6 640 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

... gene promoter activity. Several studies have reported that MREa in the promoter of the MT gene possesses transcriptional regulatory activity and that a variety of nuclear transcription factors ... of luciferase and b-galactosidase were determined. Luciferase activity was analysed with the Promega luciferase assay kit. The cells were harvested in reporter lysis buffer, and the lysate w...

Ngày tải lên: 17/03/2014, 23:20

11 628 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGAGTTTGGG-3¢. ... H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGA...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo y học: "QT interval prolongation related to psychoactive drug treatment: a comparison of monotherapy versus polytherapy" pdf

Báo cáo y học: "QT interval prolongation related to psychoactive drug treatment: a comparison of monotherapy versus polytherapy" pdf

... statistical analysis. AB and EC Mean QTc (bars indicate standard deviations) values at base-line (T0) and after four days at full dosage (T1) of antipsy-chotic therapy, in the monotherapy (1) and ... in accordance to the DSM IV. Pharmacological and medical history were obtained. Annals of General Psychiatry 2005, 4:1 http://www.annals-general-psychiatry.com/content/4/1/1 Page 5 of 6 (...

Ngày tải lên: 08/08/2014, 21:20

6 348 0
Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

... of absorptive and reflective capacity. In Organizational Learning and Knowledge 5th International Conference; 20 May 2003 Lancaster University. 37. Braadbaart O, Yusnandarshah B: Public sector ... technology/mechanisms Technology to support collaboration is available and placed rapidly in the hands of employees (KMAT)[103] Promoting external contacts We have a system that allows us...

Ngày tải lên: 11/08/2014, 05:21

15 386 0
Báo cáo y học: " Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages" pps

Báo cáo y học: " Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages" pps

... warm and personal. (vi) Category 6 - Education of the friend or family member (n=30). A substantial minority of participants indicated that an advantage of speaking to family and friends was ... to you may fob it off and say it will go away or you’ll feel better and the problem may escalate”. (viii) Category 8 - Accessibility issues Two participants indicated that lack of s...

Ngày tải lên: 11/08/2014, 16:21

35 658 0
Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

... Stimulatory and inhibitory sig- nals normally confine myofibroblasts to the period of pulmonary alveolarization and myofibroblasts are rarely observed in the adult lung [18]. Understanding more about ... followed by Alexa-Fluor 647-conjugated secondary antibody (A6 47, y- axis). Negative controls stained with the secondary antibody only are shown in A and E. To analyze the flow cyto...

Ngày tải lên: 12/08/2014, 14:20

17 203 0
Từ khóa:
w