Báo cáo y học: " “I’m on it 24/7 at the moment": A qualitative examination of multi-screen viewing behaviours among UK 10-11 year old" pptx

Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"

... fractures at the site of hip spacer im- plantation should be treated when an unstable joint situation results, the outcome of the surgery is en- dangered or the mobilisation of the patient is hereby ... at the site of hip spacer implantation. Right: Treatment consisted of spacer removal, and insertion of a cement-coated modular prosthesis with a...

Ngày tải lên: 26/10/2012, 09:53

6 455 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5Â-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3Â. C17 0A: 5Â-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3Â.C-213S:5Â-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3Â. C25 7A: 5ÂGCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3Â. ... H24 4A: 5Â-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3Â. D21 6A: 5Â-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3Â All of the primers were 5Â-phosphoryla...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo Y học: Conditionally immortalized adrenocortical cell lines at undifferentiated states exhibit inducible expression of glucocorticoid-synthesizing genes pot

Báo cáo Y học: Conditionally immortalized adrenocortical cell lines at undifferentiated states exhibit inducible expression of glucocorticoid-synthesizing genes pot

... (Eur. J. Biochem. 269)81 Conditionally immortalized adrenocortical cell lines at undifferentiated states exhibit inducible expression of glucocorticoid-synthesizing genes Kuniaki Mukai 1 , Hideko ... i ndicate that mice exhibit a functionally undifferentiated cell layer analogous to that observedinrats. Establishment of immortalized adrenocortical cel...

Ngày tải lên: 31/03/2014, 15:20

13 336 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt

báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt

... in both the public and private sectors. Unfortunately, beyond data on nationality and year of arrival as derived from immigration and registration data, no further information was available on ... Data management was facilitated by the use of the MaxQDA qualitative data analysis package. Results Of the 21 nurses interviewed, only four stated that they intended to remai...

Ngày tải lên: 18/06/2014, 17:20

12 495 0
Báo cáo y học: "Postictal psychosis: presymptomatic risk factors and the need for further investigation of genetics and pharmacotherapy" doc

Báo cáo y học: "Postictal psychosis: presymptomatic risk factors and the need for further investigation of genetics and pharmacotherapy" doc

... purposes) Annals of General Psychiatry Open Access Case report Postictal psychosis: presymptomatic risk factors and the need for further investigation of genetics and pharmacotherapy Eric M Morrow* 1 , ... I. Symmetry and convergence of the corticocortical connections of the left and the right principal sulcus (PS) and the left and the right s...

Ngày tải lên: 08/08/2014, 21:20

6 514 0
Báo cáo y học: "Osteoarthritis and nutrition. From nutraceuticals to functional foods: a systematic review of the scientific evidence" pps

Báo cáo y học: "Osteoarthritis and nutrition. From nutraceuticals to functional foods: a systematic review of the scientific evidence" pps

... enzymes, decreasing the activities of arylsulfatase A and arysulfatase B, an N-acetyl- galactosaminidase-4-sulfatase, but increasing the activity of acid phosphatase in normal and OA chondrocytes ... further research is needed to evalu- ate the safety and potential benefits of cetyl myristoleate and cetylated fatty acids in the treatment of OA. Vitamins and miner...

Ngày tải lên: 09/08/2014, 08:22

22 547 0
Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

... evidence-based practice? A comparative analysis of measurement tools for organisational context Beverley French* 1 , Lois H Thomas 1 , Paula Baker 2 , Christopher R Burton 3 , Lindsay Pennington 4 ... each category. Tool item analysis Table 3 summarises the organisational attributes for each category. Attributes are based on a composite of items extracted from...

Ngày tải lên: 11/08/2014, 05:21

15 386 0
Báo cáo y học: " Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages" pps

Báo cáo y học: " Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages" pps

... available soon. Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages BMC Psychiatry 2011, 11:196 doi:10.1186/1471-244X-11-196 Kathleen ... risks. Advantages of informal help seeking The primary advantage of consulting family and friends was the support they provided, particularly in...

Ngày tải lên: 11/08/2014, 16:21

35 658 0
Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

... harvested by trypsinization followed by gentle scraping and centrifugation. Preparation of freshly isolated mouse lung fibroblasts for Flow Cytometry analysis of α SMA and Ki67 Freshly isolated mouse ... of PDGF-Rα expression in mouse lung fibroblasts changes during alveolar development. Mouse lung fibroblasts were isolated from either wildtype (WT, A) or mice carry...

Ngày tải lên: 12/08/2014, 14:20

17 203 0
Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

... continued ischemia, IABP therapy may be used in an attempt to improve patency of an infarct-related coronary artery (IRA) and reduce the rates of recurrent myocardial ischemia and its sequelae. The mechanism for ... Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction...

Ngày tải lên: 12/08/2014, 18:20

6 575 0
Báo cáo y học: " International perspectives on intensive care at the end-of-life: the futility movement seems alive and well" ppt

Báo cáo y học: " International perspectives on intensive care at the end-of-life: the futility movement seems alive and well" ppt

... [3]. What this book adds to these important issues is that it demonstrates considerable variability in the rationales toward application of the principle of medical futility, and variation in the ... survival for that patient’ [4], and reasoned that such therapy could reasonably be withheld without consent from patients or their families. Several years later, the Society for Crit...

Ngày tải lên: 12/08/2014, 19:22

2 312 0
Báo cáo y học: "Polysaccharopeptides derived from Coriolus versicolor potentiate the S-phase specific cytotoxicity of Camptothecin (CPT) on human leukemia HL-60 cells" pps

Báo cáo y học: "Polysaccharopeptides derived from Coriolus versicolor potentiate the S-phase specific cytotoxicity of Camptothecin (CPT) on human leukemia HL-60 cells" pps

... work is properly cited. Research Polysaccharopeptides derived from Coriolus versicolor potentiate the S-phase specific cytotoxicity of Camptothecin (CPT) on human leukemia HL-60 cells Jennifer ... article as: Wan et al., Polysaccharopeptides derived from Coriolus versicolor potentiate the S-phase specific cytotoxicity of Camptothecin (...

Ngày tải lên: 13/08/2014, 15:21

10 185 0
Báo cáo y học: "Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational cohort study" pptx

Báo cáo y học: "Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational cohort study" pptx

... this article as: den Hartog et al., Spontaneous hypothermia on inten- sive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational ... original work is properly cited. Research Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neuro...

Ngày tải lên: 13/08/2014, 20:22

5 407 0
Báo cáo y học: " “I’m on it 24/7 at the moment": A qualitative examination of multi-screen viewing behaviours among UK 10-11 year old" pptx

Báo cáo y học: " “I’m on it 24/7 at the moment": A qualitative examination of multi-screen viewing behaviours among UK 10-11 year old" pptx

... confident that the data presented here are an accurate representa- tion of the views of children in the local area. Conclusions The data from this qualitative study indicate that con- temporary ... 8:85 http://www.ijbnpa.org/content/8/1/85 Page 6 of 8 RESEARC H Open Access “I’m on it 24/7 at the moment": A qualitative examination of multi-screen...

Ngày tải lên: 14/08/2014, 08:20

8 417 0
Báo cáo y học: "ystems biology: where it’s at in 2005" ppsx

Báo cáo y học: "ystems biology: where it’s at in 2005" ppsx

... a library of fluo- rescently tagged cDNAs in vivo using live cell arrays (similar to those described by Sabatini), again with or without stimu- lation of a signaling pathway. Phosphorylation events ... move beyond the constraints of studying only a few rather arbitrarily chosen model organ- isms and out into the diversity of pathologically, agricultur- ally, or evolutionarily interesting sp...

Ngày tải lên: 14/08/2014, 14:21

4 186 0
Từ khóa:
w